ID: 1024602876

View in Genome Browser
Species Human (GRCh38)
Location 7:51000326-51000348
Sequence TCCTTCCCTTCTGTTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024602875_1024602876 -10 Left 1024602875 7:51000313-51000335 CCTTGTGCAGCTCTCCTTCCCTT No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data
1024602873_1024602876 14 Left 1024602873 7:51000289-51000311 CCCTCTACAGAGCTCTGGTTTTC No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data
1024602874_1024602876 13 Left 1024602874 7:51000290-51000312 CCTCTACAGAGCTCTGGTTTTCA No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data
1024602871_1024602876 23 Left 1024602871 7:51000280-51000302 CCAGAGGGGCCCTCTACAGAGCT No data
Right 1024602876 7:51000326-51000348 TCCTTCCCTTCTGTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024602876 Original CRISPR TCCTTCCCTTCTGTTCTCCT TGG Intergenic
No off target data available for this crispr