ID: 1024602884

View in Genome Browser
Species Human (GRCh38)
Location 7:51000366-51000388
Sequence CTCTATTCAAGGAGTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024602878_1024602884 12 Left 1024602878 7:51000331-51000353 CCCTTCTGTTCTCCTTGGACTCT No data
Right 1024602884 7:51000366-51000388 CTCTATTCAAGGAGTCCACCAGG No data
1024602875_1024602884 30 Left 1024602875 7:51000313-51000335 CCTTGTGCAGCTCTCCTTCCCTT No data
Right 1024602884 7:51000366-51000388 CTCTATTCAAGGAGTCCACCAGG No data
1024602879_1024602884 11 Left 1024602879 7:51000332-51000354 CCTTCTGTTCTCCTTGGACTCTC No data
Right 1024602884 7:51000366-51000388 CTCTATTCAAGGAGTCCACCAGG No data
1024602877_1024602884 16 Left 1024602877 7:51000327-51000349 CCTTCCCTTCTGTTCTCCTTGGA No data
Right 1024602884 7:51000366-51000388 CTCTATTCAAGGAGTCCACCAGG No data
1024602880_1024602884 0 Left 1024602880 7:51000343-51000365 CCTTGGACTCTCAGCTCCATCTC No data
Right 1024602884 7:51000366-51000388 CTCTATTCAAGGAGTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024602884 Original CRISPR CTCTATTCAAGGAGTCCACC AGG Intergenic
No off target data available for this crispr