ID: 1024603397

View in Genome Browser
Species Human (GRCh38)
Location 7:51006528-51006550
Sequence GTGAATTCAACAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024603392_1024603397 13 Left 1024603392 7:51006492-51006514 CCCAGTATGGACTGCCTCAACAA No data
Right 1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG No data
1024603389_1024603397 26 Left 1024603389 7:51006479-51006501 CCCTGAGAAGCTGCCCAGTATGG No data
Right 1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG No data
1024603391_1024603397 25 Left 1024603391 7:51006480-51006502 CCTGAGAAGCTGCCCAGTATGGA No data
Right 1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG No data
1024603393_1024603397 12 Left 1024603393 7:51006493-51006515 CCAGTATGGACTGCCTCAACAAC No data
Right 1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG No data
1024603394_1024603397 -1 Left 1024603394 7:51006506-51006528 CCTCAACAACTTCTCTTCCTTTG No data
Right 1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024603397 Original CRISPR GTGAATTCAACAGGAAACAC TGG Intergenic
No off target data available for this crispr