ID: 1024604662

View in Genome Browser
Species Human (GRCh38)
Location 7:51013716-51013738
Sequence GGCTGGGAGGACGGCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024604651_1024604662 23 Left 1024604651 7:51013670-51013692 CCACAGGGTCGAGATAAGAAGGG No data
Right 1024604662 7:51013716-51013738 GGCTGGGAGGACGGCCCTGCTGG No data
1024604649_1024604662 24 Left 1024604649 7:51013669-51013691 CCCACAGGGTCGAGATAAGAAGG No data
Right 1024604662 7:51013716-51013738 GGCTGGGAGGACGGCCCTGCTGG No data
1024604647_1024604662 26 Left 1024604647 7:51013667-51013689 CCCCCACAGGGTCGAGATAAGAA No data
Right 1024604662 7:51013716-51013738 GGCTGGGAGGACGGCCCTGCTGG No data
1024604648_1024604662 25 Left 1024604648 7:51013668-51013690 CCCCACAGGGTCGAGATAAGAAG No data
Right 1024604662 7:51013716-51013738 GGCTGGGAGGACGGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024604662 Original CRISPR GGCTGGGAGGACGGCCCTGC TGG Intergenic