ID: 1024604690

View in Genome Browser
Species Human (GRCh38)
Location 7:51013923-51013945
Sequence CGTGCTCAGGTGAGGAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024604690_1024604698 7 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604698 7:51013953-51013975 GCCCTCAGTGAGCTCGGGTCTGG No data
1024604690_1024604696 1 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604696 7:51013947-51013969 TGAGCTGCCCTCAGTGAGCTCGG No data
1024604690_1024604702 12 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604702 7:51013958-51013980 CAGTGAGCTCGGGTCTGGGAAGG No data
1024604690_1024604697 2 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604690_1024604703 18 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604703 7:51013964-51013986 GCTCGGGTCTGGGAAGGCTCTGG No data
1024604690_1024604700 8 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604700 7:51013954-51013976 CCCTCAGTGAGCTCGGGTCTGGG No data
1024604690_1024604704 25 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024604690 Original CRISPR CGTGCTCAGGTGAGGAGTCG GGG (reversed) Intergenic