ID: 1024604695

View in Genome Browser
Species Human (GRCh38)
Location 7:51013936-51013958
Sequence GAGGGCAGCTCACCGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024604695_1024604702 -1 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604702 7:51013958-51013980 CAGTGAGCTCGGGTCTGGGAAGG No data
1024604695_1024604700 -5 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604700 7:51013954-51013976 CCCTCAGTGAGCTCGGGTCTGGG No data
1024604695_1024604704 12 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604695_1024604698 -6 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604698 7:51013953-51013975 GCCCTCAGTGAGCTCGGGTCTGG No data
1024604695_1024604705 24 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604705 7:51013983-51014005 CTGGCGCTTGGTTAGCTCTGAGG No data
1024604695_1024604703 5 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604703 7:51013964-51013986 GCTCGGGTCTGGGAAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024604695 Original CRISPR GAGGGCAGCTCACCGTGCTC AGG (reversed) Intergenic