ID: 1024604697

View in Genome Browser
Species Human (GRCh38)
Location 7:51013948-51013970
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024604688_1024604697 12 Left 1024604688 7:51013913-51013935 CCCTATCGCTCCCCGACTCCTCA No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604693_1024604697 0 Left 1024604693 7:51013925-51013947 CCGACTCCTCACCTGAGCACGGT No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604690_1024604697 2 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604691_1024604697 1 Left 1024604691 7:51013924-51013946 CCCGACTCCTCACCTGAGCACGG No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604694_1024604697 -6 Left 1024604694 7:51013931-51013953 CCTCACCTGAGCACGGTGAGCTG No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604687_1024604697 13 Left 1024604687 7:51013912-51013934 CCCCTATCGCTCCCCGACTCCTC No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data
1024604689_1024604697 11 Left 1024604689 7:51013914-51013936 CCTATCGCTCCCCGACTCCTCAC No data
Right 1024604697 7:51013948-51013970 GAGCTGCCCTCAGTGAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024604697 Original CRISPR GAGCTGCCCTCAGTGAGCTC GGG Intergenic