ID: 1024604704

View in Genome Browser
Species Human (GRCh38)
Location 7:51013971-51013993
Sequence TCTGGGAAGGCTCTGGCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024604691_1024604704 24 Left 1024604691 7:51013924-51013946 CCCGACTCCTCACCTGAGCACGG No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604694_1024604704 17 Left 1024604694 7:51013931-51013953 CCTCACCTGAGCACGGTGAGCTG No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604690_1024604704 25 Left 1024604690 7:51013923-51013945 CCCCGACTCCTCACCTGAGCACG No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604693_1024604704 23 Left 1024604693 7:51013925-51013947 CCGACTCCTCACCTGAGCACGGT No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604699_1024604704 -6 Left 1024604699 7:51013954-51013976 CCCTCAGTGAGCTCGGGTCTGGG No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604701_1024604704 -7 Left 1024604701 7:51013955-51013977 CCTCAGTGAGCTCGGGTCTGGGA No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data
1024604695_1024604704 12 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604704 7:51013971-51013993 TCTGGGAAGGCTCTGGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024604704 Original CRISPR TCTGGGAAGGCTCTGGCGCT TGG Intergenic