ID: 1024604705

View in Genome Browser
Species Human (GRCh38)
Location 7:51013983-51014005
Sequence CTGGCGCTTGGTTAGCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024604701_1024604705 5 Left 1024604701 7:51013955-51013977 CCTCAGTGAGCTCGGGTCTGGGA No data
Right 1024604705 7:51013983-51014005 CTGGCGCTTGGTTAGCTCTGAGG No data
1024604694_1024604705 29 Left 1024604694 7:51013931-51013953 CCTCACCTGAGCACGGTGAGCTG No data
Right 1024604705 7:51013983-51014005 CTGGCGCTTGGTTAGCTCTGAGG No data
1024604699_1024604705 6 Left 1024604699 7:51013954-51013976 CCCTCAGTGAGCTCGGGTCTGGG No data
Right 1024604705 7:51013983-51014005 CTGGCGCTTGGTTAGCTCTGAGG No data
1024604695_1024604705 24 Left 1024604695 7:51013936-51013958 CCTGAGCACGGTGAGCTGCCCTC No data
Right 1024604705 7:51013983-51014005 CTGGCGCTTGGTTAGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024604705 Original CRISPR CTGGCGCTTGGTTAGCTCTG AGG Intergenic