ID: 1024609220

View in Genome Browser
Species Human (GRCh38)
Location 7:51049335-51049357
Sequence TCTTTTATGAAGGAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 477}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024609211_1024609220 13 Left 1024609211 7:51049299-51049321 CCCAGTGAGTTTCCTGATGGGTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG 0: 1
1: 0
2: 4
3: 50
4: 477
1024609212_1024609220 12 Left 1024609212 7:51049300-51049322 CCAGTGAGTTTCCTGATGGGTGA 0: 1
1: 0
2: 1
3: 13
4: 122
Right 1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG 0: 1
1: 0
2: 4
3: 50
4: 477
1024609210_1024609220 14 Left 1024609210 7:51049298-51049320 CCCCAGTGAGTTTCCTGATGGGT 0: 1
1: 0
2: 2
3: 22
4: 191
Right 1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG 0: 1
1: 0
2: 4
3: 50
4: 477
1024609216_1024609220 1 Left 1024609216 7:51049311-51049333 CCTGATGGGTGAGGGGTATGTCT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG 0: 1
1: 0
2: 4
3: 50
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024609220 Original CRISPR TCTTTTATGAAGGAGAAGGA GGG Intronic
901321575 1:8343377-8343399 TCCTGGATGAAGGTGAAGGAGGG + Intronic
902470053 1:16642974-16642996 TCTTGTTGGGAGGAGAAGGAAGG - Intergenic
904949480 1:34224825-34224847 TCCTTTACTAAGGAGAAAGAGGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905817382 1:40962335-40962357 TATTTTATTAAGGACAAGAAAGG + Intergenic
906919294 1:50047391-50047413 AATTTTATGAAGGTCAAGGAGGG + Intergenic
907194799 1:52677859-52677881 TCTTTATTGAAGGAAAGGGAAGG - Intergenic
907680152 1:56555402-56555424 TCACTTATGCAGGAGAAGGAAGG + Intronic
908538374 1:65099907-65099929 TCATTAATGAAGGAGAAATAAGG - Intergenic
908865366 1:68542641-68542663 ACTTTTATGGAGCTGAAGGAGGG - Intergenic
908905338 1:69002067-69002089 AATTTTATGAAGCAGAAGGAGGG - Intergenic
908943411 1:69464482-69464504 TTTTTTATAAAGTATAAGGAAGG + Intergenic
909159873 1:72133400-72133422 TCTTTTATGAAGGTAAGGAAAGG + Intronic
909684645 1:78333723-78333745 TCTTTTATGAAGGATTGGGGAGG + Intronic
910314040 1:85861561-85861583 TTTTTTCTGCAGTAGAAGGAAGG + Intronic
911655585 1:100439282-100439304 TCTTTTTTGTAGGGGAAGGATGG + Intronic
912177851 1:107182778-107182800 TCTCTCATGAAGGATAAAGAAGG - Intronic
912421685 1:109546581-109546603 TCTTTGATGTATGTGAAGGAAGG - Exonic
912757409 1:112335915-112335937 CCTATAATGCAGGAGAAGGAAGG - Intergenic
914698052 1:150103914-150103936 TATTTTATTAAGAAGAAGGGAGG - Intronic
914948808 1:152091542-152091564 TTTGTTTTGAAGGAGAAGAAAGG - Intergenic
916891144 1:169113674-169113696 TCTTTTAGGAAGGGGATGGAAGG - Intronic
917368809 1:174265052-174265074 GCCTTTATGAAGGAGAAAAATGG + Intronic
917566072 1:176212787-176212809 TATTTTATGAAGGTATAGGAAGG + Intergenic
917583974 1:176406115-176406137 TCTCTTCTGAAGTGGAAGGAAGG + Intergenic
917702934 1:177599331-177599353 GCTTTTTTGAAGGCAAAGGATGG - Intergenic
918236058 1:182581862-182581884 TCATTTCTGAAGAATAAGGAGGG - Intronic
918490630 1:185077941-185077963 TCATTTATAAAGGACAAGTAAGG + Intronic
920360980 1:205416002-205416024 TTTTTTAAGAAGGGGCAGGAGGG + Intronic
920432199 1:205926230-205926252 TTTTCTATGAAGAAGAAGCAAGG - Intronic
920784447 1:209027426-209027448 GCTTTTTTGAAGGGGAAGGTGGG + Intergenic
920840280 1:209548148-209548170 TCTCTTAGGAGGGAGAAGGATGG - Intergenic
921111255 1:212039453-212039475 TCTTTTATAAAGTGGAAGAAAGG + Intronic
921122103 1:212146213-212146235 TCCTTGATGGAGGAGAAGGGAGG + Intergenic
921279774 1:213554932-213554954 TCTTCTATAAAGGTGACGGAGGG - Intergenic
922642163 1:227245228-227245250 TCTGTTCTTAAGCAGAAGGAAGG - Intronic
924534986 1:244927880-244927902 TCTATCAGGAAGGAGAAAGACGG + Intergenic
924947610 1:248856792-248856814 ACTTTTAAGAAGGAGGAGGAGGG + Intronic
1063128584 10:3157929-3157951 TGTTATATGACAGAGAAGGAAGG + Intronic
1065087011 10:22188551-22188573 TCTTTTTGGTATGAGAAGGAGGG + Intergenic
1065314486 10:24449088-24449110 TCTGTTATGATTGATAAGGAAGG + Intronic
1065625876 10:27627755-27627777 TCTTTACTGAATGCGAAGGAGGG - Intergenic
1066752921 10:38677484-38677506 TCATATGTGAAGGAGAAGTAAGG + Intergenic
1067961105 10:50851216-50851238 TCATCTATGAAGGAGTAGGAGGG + Intronic
1068247687 10:54393971-54393993 TGTTTTAGGATGGTGAAGGAAGG + Intronic
1068365824 10:56048743-56048765 TGTATAATGAAGGAGAAAGATGG + Intergenic
1068628817 10:59278514-59278536 TCTTTGATGAGGGAGAAGGGTGG + Intronic
1068996660 10:63213601-63213623 GATTATATGAAGCAGAAGGATGG + Exonic
1070187626 10:74081228-74081250 TCTGTTTAGAAGGGGAAGGAGGG + Intronic
1070743636 10:78919344-78919366 ACTTTTATGATGGAGGAGTAAGG + Intergenic
1073332355 10:102678814-102678836 TCTGTTATGGAGGCAAAGGAGGG + Intronic
1073585699 10:104707913-104707935 TCTTTTATTGAAGAGAAGGTTGG + Intronic
1073872039 10:107876760-107876782 TTTTTTATGCAGTATAAGGAAGG - Intergenic
1074408415 10:113201389-113201411 TCTCTTCTCAAGCAGAAGGAAGG - Intergenic
1074478404 10:113794830-113794852 TATTTTGTGAAGGACAATGAGGG - Intergenic
1074542386 10:114375725-114375747 ACATTTTTGAAGGATAAGGAGGG + Intronic
1074646888 10:115464790-115464812 TTTTTTATGAAAGTAAAGGATGG - Intronic
1075131572 10:119744315-119744337 TGTTTTAGCAAGGGGAAGGATGG - Intronic
1075930822 10:126293795-126293817 TATTTTAGGAACTAGAAGGAAGG - Intronic
1076506992 10:130984826-130984848 TCTTGTAAGAAGTGGAAGGAAGG - Intergenic
1076944063 10:133631956-133631978 TGTTTTATGTAGAAGAATGAGGG - Intergenic
1077473130 11:2774086-2774108 TCTTATAGGAAGGAGAAACAGGG + Intronic
1077765365 11:5153833-5153855 TTTTTTTTGAAAGAAAAGGAAGG + Intronic
1078710155 11:13783558-13783580 ACTTTTATGAACCAGAAAGAGGG - Intergenic
1079706932 11:23632805-23632827 TCTCTTGTCAAGCAGAAGGAAGG - Intergenic
1080607142 11:33872662-33872684 TGTTTTATTTAGGAGAAGAAGGG - Intronic
1080927452 11:36772694-36772716 TCTTCTATGAAGAAGAAATATGG - Intergenic
1081485994 11:43529638-43529660 TCTTGTAAGAAAGAGATGGATGG - Intergenic
1084555730 11:69874745-69874767 ACTTTTATGGAGGAGAAGTGAGG + Intergenic
1084899998 11:72302537-72302559 TCTTTTAAGGAAGAGAATGAGGG - Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1085813751 11:79713052-79713074 TTTTTTATGAGGTATAAGGAAGG + Intergenic
1086775956 11:90833197-90833219 TCTATAAAGAGGGAGAAGGAGGG + Intergenic
1086966970 11:93038540-93038562 TATTTAAAGAAAGAGAAGGAAGG - Intergenic
1087340962 11:96906554-96906576 TCTTTGGGGAAGGAAAAGGAAGG + Intergenic
1087734919 11:101821026-101821048 TATTTCATGAAGGATAATGAAGG + Intronic
1089298342 11:117482920-117482942 TCTTGTTTGAAGGAACAGGAGGG - Intronic
1090492520 11:127177256-127177278 TATTTTATGCAGGGGAAGGCAGG + Intergenic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091406290 12:211491-211513 TCTGTTATGAGGGAGAAGGCAGG + Intronic
1091524823 12:1288731-1288753 TCTTTTCAGAAGTAGAAGGTAGG - Intronic
1091632286 12:2171144-2171166 TCTTTTCTGAAGGCCAGGGAAGG + Intronic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1093078881 12:14787075-14787097 GCTTTCATGAAAGAGATGGAAGG - Exonic
1094107235 12:26827058-26827080 TCTCTTTTAAAGGTGAAGGAGGG - Intronic
1095552617 12:43460822-43460844 TCTTTTTTGAAGGAGTGGAATGG - Intronic
1095985308 12:47995403-47995425 TCTTCTATGAAGAAGAAAGATGG + Intronic
1096401123 12:51307319-51307341 TCTTTCTTGAAGGAGAAAAAAGG + Intronic
1096567495 12:52493558-52493580 TGTCTGATGAAGAAGAAGGAGGG - Intergenic
1098111586 12:67127559-67127581 TCTTTTATAAAAGAGAAAAAAGG - Intergenic
1098929354 12:76392738-76392760 TCTTTTAGGAAGGTGCTGGATGG - Exonic
1099043858 12:77691449-77691471 TCTTTTATGATAGAGAAGATTGG - Intergenic
1099157613 12:79198802-79198824 TCTTTTAGGAAGAGGAATGAAGG - Intronic
1099608758 12:84838421-84838443 CCATTTATGAAGGAAAAGTATGG - Intergenic
1101956172 12:109214257-109214279 TCTTTTATGAAAAAGAAAAAAGG + Intronic
1102616267 12:114157318-114157340 TCTTGTATGATGGACAGGGATGG - Intergenic
1102660517 12:114523379-114523401 TCTTTTCTGAAGGGCAAGGTAGG - Intergenic
1102749958 12:115284162-115284184 TCTGTTATAAAGGAGGAGAAAGG - Intergenic
1103059214 12:117845323-117845345 ACTTTTAAGAAGCAGAAGGCAGG - Intronic
1103311461 12:120012762-120012784 TCTTTTTTAAAGGAAAGGGAAGG + Intronic
1105658864 13:22470941-22470963 TCCTTTATAAAGGAAAAAGAGGG + Intergenic
1106292315 13:28375534-28375556 TCTTTTAGGAGGTAGAAGAAAGG - Intronic
1106598941 13:31170859-31170881 TCTGCTATGCAGGAAAAGGAGGG - Intergenic
1106901632 13:34360051-34360073 GCTTTTATCAAGAAGTAGGAAGG - Intergenic
1107196756 13:37661707-37661729 TCATTTATGAAGGAAGAGGTTGG + Intronic
1107460254 13:40595057-40595079 CCTTTTGTGAGGGAAAAGGAGGG - Intronic
1108563119 13:51666343-51666365 CCTTTTATGAAGGAGCAAAAAGG + Intronic
1108871123 13:54987792-54987814 CCTTTTATGAAAGAGATTGAAGG - Intergenic
1110229479 13:73153383-73153405 TATTTGTTGAAAGAGAAGGAGGG - Intergenic
1110615783 13:77540561-77540583 TCTTTCCTGAAGGAAAATGAGGG + Intronic
1110743600 13:79026711-79026733 TCTTTTAAAAAGAAGAAGAAAGG + Intergenic
1111136637 13:84054685-84054707 GCTTTTAAGAAACAGAAGGAAGG + Intergenic
1113149245 13:107243296-107243318 GATCTTAAGAAGGAGAAGGAAGG - Intronic
1113406521 13:110045972-110045994 TCTGTGATGCAGGAGAAGGTGGG - Intergenic
1113420939 13:110170893-110170915 TGTGTTATTAAAGAGAAGGAGGG - Intronic
1113755848 13:112810133-112810155 TTTTTAATGAAAGAGAAGAATGG + Intronic
1113961395 13:114128246-114128268 TGTTTTGTGAAGGTGAGGGAGGG - Intronic
1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG + Intergenic
1115998869 14:39221570-39221592 ACTTTTTTGAAGGGGAAGGTGGG + Intergenic
1116318559 14:43429785-43429807 GCTTTTAAGAATGAGAAGAAGGG + Intergenic
1116797284 14:49405369-49405391 GCTATTATGAAAGAGGAGGAGGG - Intergenic
1117694754 14:58349256-58349278 TATTTTATGTAGGATGAGGAAGG - Intronic
1118076930 14:62309541-62309563 TCTTTTGCTAAGGGGAAGGAGGG + Intergenic
1118249218 14:64142686-64142708 TATTTTAGCAAGGTGAAGGATGG - Intronic
1121214130 14:92234128-92234150 TGTTTTATGTAGGAGAAAGATGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1125167505 15:36725200-36725222 TTATCTGTGAAGGAGAAGGAAGG - Intronic
1127010381 15:54619778-54619800 TATTGTATGAATGAGAAGTATGG + Intronic
1127137639 15:55941249-55941271 TCTTTAAAGAAAAAGAAGGAAGG - Intronic
1127810152 15:62558869-62558891 TCTTTTATCAGGGAGAACAAAGG - Intronic
1127921698 15:63499663-63499685 CCTTTTATGAAGGAGATGAGGGG - Intergenic
1128124185 15:65179055-65179077 ACGTTTATGAAGGAGAAAAAAGG + Intronic
1128179275 15:65587314-65587336 CCATTTATGAAGCAGGAGGATGG + Intronic
1128660652 15:69498703-69498725 TCCTTGAAGGAGGAGAAGGAGGG - Intergenic
1128958446 15:71974243-71974265 AGTTTGATGAAGGAGTAGGATGG + Intronic
1129556127 15:76511788-76511810 TGTTTGCTGAATGAGAAGGAAGG + Intronic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1130896790 15:88176904-88176926 TCTATTTGTAAGGAGAAGGAAGG + Intronic
1131064940 15:89428516-89428538 TCTATTAGGAAGGAGAAAGAGGG + Intergenic
1131161062 15:90105122-90105144 TACTTTTTGAAGGAGAAAGAGGG + Intergenic
1131433079 15:92402043-92402065 TCTTTTATGAAAGGGAGTGATGG + Intronic
1132230698 15:100181722-100181744 TCTCTCCTGAAGGAGGAGGAAGG + Intronic
1132311280 15:100859696-100859718 TATTTTATGCATGAGAAGCAAGG - Intergenic
1132983004 16:2748873-2748895 TCTTTTCTGGAGGGGGAGGAGGG - Intergenic
1133545125 16:6798982-6799004 TCTTTTAGGAAAAAGAAGAATGG + Intronic
1134746860 16:16595191-16595213 GCTTGTATGAAGGAGTAGGCGGG + Intergenic
1134998614 16:18758472-18758494 GCTTGTATGAAGGAGTAGGCGGG - Intergenic
1136709573 16:32225378-32225400 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136758336 16:32704035-32704057 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1136809772 16:33166340-33166362 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136816248 16:33276420-33276442 TATTTGATGGAGGAGGAGGAGGG + Intronic
1137433114 16:48434234-48434256 TCTTTAATGGTGGAGGAGGAAGG + Intronic
1137468101 16:48729591-48729613 TCTTTTAGGAAGAAGAAGGAGGG + Intergenic
1137687131 16:50393835-50393857 GCTTTTATGAAGGAGAATTTGGG + Intergenic
1137894114 16:52192780-52192802 TCTTCAGTGAAAGAGAAGGATGG + Intergenic
1138157801 16:54722125-54722147 GCATTTGTGAAGGAGCAGGAGGG - Intergenic
1138274337 16:55721361-55721383 TCTATTAAGAAGGACAAAGAAGG + Intergenic
1140071992 16:71658563-71658585 CCTTTTATAAAGAAGAAGAAAGG - Intronic
1140718695 16:77750746-77750768 TTTTTTATGAAAAAGATGGATGG + Intergenic
1140836097 16:78795380-78795402 TGTTTTGTGAATGAGTAGGATGG + Intronic
1141201592 16:81902632-81902654 GCTTTTATGAATGGGAATGAGGG - Intronic
1141751531 16:85961655-85961677 TCTTTTGTGAAGTACACGGAGGG + Intergenic
1203060487 16_KI270728v1_random:964382-964404 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1144419286 17:15081336-15081358 TTCTTTATGAAGAAAAAGGACGG - Intergenic
1144430166 17:15183882-15183904 TCTTTTATACTGGAGAAAGAGGG + Intergenic
1144516572 17:15921700-15921722 TCTTTTTTTAATGAGAAGGGAGG - Intergenic
1144615790 17:16770474-16770496 TCTTTTCTGAATATGAAGGAAGG + Intronic
1144896912 17:18545198-18545220 TCTTTTCTGAATATGAAGGAAGG - Intergenic
1145135300 17:20399016-20399038 TCTTTTCTGAATATGAAGGAAGG + Intergenic
1146665926 17:34703491-34703513 TCTTTGATGGAGGAGCAGGTGGG - Intergenic
1147302793 17:39543244-39543266 CCTTTGATGAGGCAGAAGGAAGG + Intronic
1148544043 17:48503408-48503430 TGTTTTATGATGGAGGGGGACGG - Intergenic
1148548104 17:48532091-48532113 TTTTTTTGGAAGGAGATGGAGGG - Intergenic
1148841017 17:50497215-50497237 GCTTTTAAGAAGCAGAAGGTTGG + Intergenic
1149296430 17:55265767-55265789 CCTTTCATGGAGGAGGAGGAAGG - Intronic
1150014342 17:61538540-61538562 TCTTTTATGAAGGCTGAGGGAGG + Intergenic
1150478953 17:65495097-65495119 CCTTTCAAGATGGAGAAGGAGGG + Intergenic
1153535654 18:6098883-6098905 GCCTTTATGAAGGAGTAGGTAGG + Intronic
1155280119 18:24230592-24230614 TTTTTAATGCAGCAGAAGGAAGG + Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1156584101 18:38412751-38412773 CCTCTTTGGAAGGAGAAGGAAGG + Intergenic
1157648442 18:49301925-49301947 TATTTTGTGAGAGAGAAGGAAGG - Intronic
1157980185 18:52370832-52370854 TATTTTTTGATGGAGAAGAAAGG + Intronic
1158237791 18:55338601-55338623 TCTTTCATGAAAGAAAAAGAAGG - Intronic
1158284332 18:55862770-55862792 TCCTTTTTGAAGGACAAGTAAGG - Intergenic
1159101390 18:63962845-63962867 TCTGTGTTGAAGGAGATGGAGGG + Intronic
1159429785 18:68336825-68336847 TCTTCTATGAAAGGGAAGGAGGG - Intergenic
1159933451 18:74338519-74338541 TATTGTATAAAGGAGAAGCAGGG + Intronic
1163550658 19:17964852-17964874 TCTTTTCAGAGGGAGAAGGTGGG + Intronic
1164432959 19:28204069-28204091 TCTCTTAGGAAGGGGAAGGAAGG + Intergenic
1166452127 19:42911043-42911065 TGCTTTATGTAGGAGAAGCATGG + Intronic
925036849 2:693531-693553 TCTTTGTTGAGAGAGAAGGAAGG - Intergenic
925228437 2:2207370-2207392 TCTTTTACAAAGGACAATGATGG - Intronic
925348997 2:3188309-3188331 TCTGTAATGATGGGGAAGGATGG - Intergenic
925874564 2:8300967-8300989 TGTTTTAGGAAGGAGATAGATGG - Intergenic
925996849 2:9300388-9300410 AATTTTATAAAGGAGAAGGAGGG - Intronic
926668673 2:15553473-15553495 GCTTTTATGGAGAAGAAAGAGGG + Exonic
927110478 2:19860838-19860860 TCCTGGAGGAAGGAGAAGGAGGG - Intergenic
927729092 2:25454522-25454544 GCTGTTATGTAGGGGAAGGATGG + Intronic
929380095 2:41339137-41339159 TCTTTTAGGAAGGACAATAATGG + Intergenic
929543160 2:42837845-42837867 TCATTTCTTATGGAGAAGGATGG + Intergenic
929756228 2:44767996-44768018 TCTTTCAGGGAGGAGACGGAGGG - Intronic
930044004 2:47152975-47152997 CCTCTTTTGAAAGAGAAGGATGG - Exonic
930589954 2:53315527-53315549 TCATTCATGAAGGAGCAGGGAGG + Intergenic
930689467 2:54345473-54345495 GCTTTTGAGAAAGAGAAGGAAGG + Intronic
930895490 2:56441009-56441031 TCTTTCCTCAAGTAGAAGGAAGG + Intergenic
930934024 2:56924961-56924983 TGATTTATGAAGGATAAGTATGG + Intergenic
931257927 2:60590202-60590224 GGTTTTAAGGAGGAGAAGGAAGG - Intergenic
931485450 2:62686040-62686062 TCTTTTCTGAGGGAGATGTATGG + Intronic
932302067 2:70674578-70674600 TCTTTGATGATGGGGCAGGAAGG + Intronic
932557068 2:72833846-72833868 TCTCCTAAGAATGAGAAGGATGG - Intergenic
932689759 2:73902264-73902286 TCTCTGAAGAAGGATAAGGATGG - Intronic
935094485 2:99931401-99931423 TCTTTTATAAGGGAGAAAAAAGG + Intronic
935200411 2:100851908-100851930 TCTTTAGTGAAGGAAAAGAAAGG + Intronic
936831307 2:116651699-116651721 ACTTTAATGAAAGAGAAGCAGGG + Intergenic
936924767 2:117725115-117725137 GCTTTTAAGAAACAGAAGGATGG + Intergenic
937268259 2:120630808-120630830 TCATTTGTGAAGGAGACTGAGGG - Intergenic
937874163 2:126808617-126808639 TCTTTTTTGGTGGAGGAGGAAGG + Intergenic
937936573 2:127250055-127250077 GCTTTCATGAAAGAGATGGAAGG + Intergenic
938832483 2:135066448-135066470 TATTTTATGGAGGAGAAATAAGG + Intronic
939632445 2:144541470-144541492 TCCTGTATGAAGGAGATGAAGGG - Intergenic
940324542 2:152411521-152411543 TCTCTTAGGAAGGAGATGGGAGG - Intronic
940378803 2:152989205-152989227 TCTCTAATGGTGGAGAAGGAAGG + Intergenic
941388661 2:164884336-164884358 TCTTTTATGAGGGAGGAAGAGGG - Intergenic
941595388 2:167470596-167470618 TCTTTCCTGAAGCAGAAGGAGGG + Intergenic
943383289 2:187175415-187175437 TCTTTTATAATAGAGAAGGGAGG - Intergenic
944535383 2:200704606-200704628 TCTTTTATGAAAGAGAGTGGTGG + Intergenic
945132941 2:206594565-206594587 TCTTTTATTAAGGAAAGGTAGGG + Intronic
945335507 2:208588331-208588353 TCTTTTCTGAGGGAGAAGGAGGG - Intronic
945683154 2:212937582-212937604 TCTTTAAAGATGGAGAAAGAGGG + Intergenic
945742911 2:213685300-213685322 TCTTGTAAGAAGGAGAAAGGTGG + Intronic
946262644 2:218507666-218507688 TCTTTAATGGATGAGAATGATGG + Intronic
946474464 2:219994252-219994274 CCTTTGATGATGGAGAAGGCAGG + Intergenic
946541799 2:220692827-220692849 TCTTTTATGAAGAAGACCTAGGG + Intergenic
946700693 2:222410249-222410271 TTTTTCATGAAAGAGAAGAAAGG + Intergenic
946978498 2:225180103-225180125 TCCTTGCTGAATGAGAAGGATGG + Intergenic
947515593 2:230801267-230801289 TCTTTCAGGGAGGAGTAGGAAGG - Intronic
948040633 2:234898878-234898900 TCCTTTCAGAAGGAGAAGTAAGG - Intergenic
948061765 2:235047599-235047621 TCTGTTATGGTGGGGAAGGAAGG + Intronic
1170126394 20:12969084-12969106 TCTTTTAACAAGGAGAAGCTGGG + Intergenic
1170906602 20:20520870-20520892 TCTTGTGGGAAGGAAAAGGAAGG - Intronic
1171568250 20:26216939-26216961 TGTTTAAAGAAGGAGAAGGAAGG + Intergenic
1171781418 20:29422070-29422092 TGTTTTATGTAGAAGAAGGAGGG - Intergenic
1175375616 20:58521643-58521665 TCTTTCAGGAGGAAGAAGGAAGG + Intergenic
1175478696 20:59296169-59296191 TCTTTTAAGAGGGAGGGGGAGGG - Intergenic
1176962371 21:15173807-15173829 TCATTGATGACGGAGAGGGAAGG + Intergenic
1177630279 21:23718228-23718250 TGTTTTATGAAAGAGAAAAAAGG + Intergenic
1178117519 21:29432617-29432639 TCTTTCCTGCAGAAGAAGGATGG + Intronic
1178129423 21:29554847-29554869 TCATTTATTAACGACAAGGAAGG - Intronic
1179245186 21:39627084-39627106 TCCTTTAGGAAGGAAAAGGAAGG - Intronic
1179265012 21:39795544-39795566 TCTAGTATGAATGAGGAGGAAGG + Intronic
1179448591 21:41452037-41452059 TCTTTTATGAATGAGGAGTCAGG - Intronic
1179527191 21:41988192-41988214 TCGTTTATGTGGGAGAAGGAAGG - Exonic
1181079290 22:20403324-20403346 GCTTTTATAAAGGAGGAGGAAGG - Intronic
1183516543 22:38270182-38270204 CCACCTATGAAGGAGAAGGAGGG - Intronic
1184943516 22:47785066-47785088 TCATTCATTAAGGAGAAGCAGGG - Intergenic
950487121 3:13280503-13280525 TCTTTTGGGAAGGAGAATGCTGG - Intergenic
950532462 3:13560244-13560266 TTTTTTAGGGAGGAGAGGGAAGG + Intronic
951461708 3:22958160-22958182 TTTTTAATCAAGGAGCAGGATGG - Intergenic
951938051 3:28044516-28044538 ACTTATAGGAAGGGGAAGGAGGG - Intergenic
952323530 3:32299980-32300002 ATTTTTATGATGGAGAAGAAAGG - Intronic
953309599 3:41863850-41863872 TCTTCTCTCAAGCAGAAGGAAGG + Intronic
953333794 3:42076801-42076823 TTTTTTATGTGGCAGAAGGAAGG + Intronic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
954299380 3:49691279-49691301 TCTTGTTGGGAGGAGAAGGAAGG + Intronic
954792701 3:53144785-53144807 TCTTTTCTGGAGAAGAAGAAAGG - Intergenic
955855417 3:63267503-63267525 TCTTTTAGGATGGGAAAGGATGG + Intronic
956510728 3:69990120-69990142 CCTCTTATTAAGGAGATGGAAGG - Intergenic
956578436 3:70781854-70781876 TACTTTATCAAGTAGAAGGAAGG + Intergenic
956652225 3:71514665-71514687 ACTTGTATGAAGGAGAAAAAAGG - Intronic
956665216 3:71636081-71636103 TCGTTTATGAATAAGATGGACGG + Intergenic
957110603 3:75951399-75951421 TGTTTAAAGAAGGAGAAGGAAGG - Intronic
957237422 3:77612422-77612444 TATCATATGAAGGAGAAGAATGG - Intronic
957266820 3:77977560-77977582 TCTATTAGGAAGGAGAAAGTGGG + Intergenic
957337648 3:78852605-78852627 TATTTTAGCAATGAGAAGGAAGG + Intronic
957541840 3:81581092-81581114 TATGTTATTAAGGAGAGGGAAGG + Intronic
958035450 3:88164838-88164860 ACTTTTATGAAAGACAAAGAAGG + Intronic
958255969 3:91325243-91325265 TCTTTTGTGAAGGGGAAAGATGG - Intergenic
958587197 3:96103747-96103769 CCATTTACGTAGGAGAAGGAAGG - Intergenic
958862199 3:99457770-99457792 TCTCTTCTCAAGCAGAAGGAAGG + Intergenic
958929192 3:100190916-100190938 TCATTTATGAAGGGGAAGGATGG + Intronic
958939095 3:100290237-100290259 TCTTTTTTGGCAGAGAAGGAAGG + Intronic
958981780 3:100728925-100728947 CTTTTTAAGTAGGAGAAGGATGG + Intronic
959302893 3:104624989-104625011 TCTTTTTTGAAGGAGAAAGTAGG - Intergenic
959759080 3:109936871-109936893 TCTATTGTGAAGGATAATGAAGG + Intergenic
960118217 3:113919270-113919292 TCTTTAATGATGGAGAAGCCAGG + Intronic
960219219 3:115084804-115084826 GCATTTATGAAAGAGAAGGTGGG - Intronic
960655475 3:119999169-119999191 TCTCTTGAGAAGGAGAAAGAGGG + Intronic
963662254 3:148141750-148141772 ACTTTTATGAAGAAGGAGAAGGG + Intergenic
964092837 3:152896170-152896192 TCCTCTATGAAGGATAAGGCTGG + Intergenic
964192932 3:154026512-154026534 TCTTTTGTGAAGCAGAAGAAGGG - Intergenic
964416333 3:156452106-156452128 TCCTTTAGGAAGGGAAAGGAAGG + Intronic
964488385 3:157208978-157209000 TATTTTGTGAAGGAGCAGGGAGG + Intergenic
964614690 3:158650115-158650137 TCTTGTAAGCAGGAAAAGGATGG + Intronic
964741687 3:159973053-159973075 TGTTTTTTAAAGGGGAAGGAAGG - Intergenic
964894150 3:161574640-161574662 TCTTTCAAGAAGGAGGAGAAAGG - Intergenic
965322323 3:167265487-167265509 TCTTTCATTATGCAGAAGGAAGG + Intronic
965371574 3:167869072-167869094 TATGTTATGAAGTAGAAAGAAGG - Intergenic
965386577 3:168053739-168053761 TCTTTTATGGAGGAATGGGATGG - Intronic
965812441 3:172605342-172605364 TATTTTATGAAGGAAGAAGAAGG - Intergenic
965844463 3:172945981-172946003 CCCTTTCTGAAGCAGAAGGAAGG - Intronic
966443167 3:179969863-179969885 TATTTTCTGAAGAAGCAGGAAGG + Intronic
966757704 3:183386941-183386963 TTTCTTATGAAGCAGAAGCATGG - Intronic
967956470 3:194881194-194881216 CCTTTAATAAAGGAGAAGAAAGG - Intergenic
968017966 3:195356574-195356596 CCTCTTCTCAAGGAGAAGGACGG - Intronic
968107925 3:196015485-196015507 TCTGTTAGGAAGGAGAAAGGTGG - Intergenic
968429227 4:545449-545471 TCTCTCATCAAGCAGAAGGAAGG + Intergenic
969837907 4:9858462-9858484 ACTTTTATGAGGGAGAATGAAGG - Intronic
970430613 4:15985725-15985747 TCTTTTATGAATGTTAAGGGGGG - Intronic
970708601 4:18835275-18835297 TCTTTTATAAAGAACAAGAAAGG - Intergenic
971446476 4:26755639-26755661 TCTTCTAAGCAAGAGAAGGAAGG - Intergenic
971861581 4:32112750-32112772 TCTTTGGAGGAGGAGAAGGAAGG + Intergenic
972369511 4:38409492-38409514 CCCTTTGTGAAGGTGAAGGAGGG - Intergenic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
973272468 4:48275625-48275647 CCTTATATGAGGGAGAAGGCAGG + Intergenic
974409386 4:61519783-61519805 TGTTTTATGAAGGTGGAGGAGGG - Intronic
974710955 4:65594570-65594592 TCTTTTATGAGTGAGAAAGTAGG + Intronic
975042977 4:69768099-69768121 TCTTTAATGAGGAAGAAGGATGG + Intronic
975199462 4:71568876-71568898 TGTTCTATGAAGGAGATTGAGGG + Exonic
975647902 4:76563912-76563934 TCCTGTATGAAGGGGCAGGAAGG + Intronic
976079998 4:81345402-81345424 TCTTGGAGGAAGGAGCAGGAGGG + Intergenic
976249991 4:83040585-83040607 TCTTGTAGGGAGGAGAAGGTGGG - Intronic
976287144 4:83381660-83381682 GCTTTTAGGAAACAGAAGGAAGG - Intergenic
976892098 4:90062123-90062145 TCTTTTATGAAACAGAAAGCTGG - Intergenic
977373807 4:96173722-96173744 TATTTGATGGAGGAGAAGTAAGG + Intergenic
978810909 4:112848531-112848553 ACGTTTGAGAAGGAGAAGGAAGG - Intronic
978910914 4:114063002-114063024 TGTTTTATAAGGCAGAAGGAAGG + Intergenic
979452067 4:120884720-120884742 TGTTCTTTGAAGGAGGAGGATGG - Intronic
979945773 4:126829925-126829947 TCTCTTCTCAAGAAGAAGGAAGG - Intergenic
979956651 4:126961259-126961281 TCTTTTATAAAGATGAAGGAGGG + Intergenic
981096792 4:140790309-140790331 TCTTTCAGTGAGGAGAAGGAGGG + Intergenic
981137553 4:141228843-141228865 TCCTTTATAAAGGAAAAGCATGG - Intronic
981203862 4:142015873-142015895 TCTCTCTTGAAGCAGAAGGAAGG + Intergenic
981757059 4:148151985-148152007 TCTTTTATGATGGCAAAGAAGGG + Intronic
981963000 4:150564357-150564379 TTTTGTATGAGGGATAAGGAAGG - Intronic
981969020 4:150642378-150642400 TCTTTTATGAAAGAAAAGAATGG + Intronic
982377400 4:154708481-154708503 GGTTTTATGAATAAGAAGGATGG - Intronic
982429951 4:155311345-155311367 TCTGTTATGAAGGAGTAATAGGG + Intergenic
982839723 4:160168488-160168510 TTTTGTATGAAGTATAAGGAAGG + Intergenic
982889576 4:160831044-160831066 TCTTTTATGTGGCAGAAGCAAGG + Intergenic
984119065 4:175719844-175719866 GCTTTAATGAAAGAGAGGGAGGG - Intronic
984506668 4:180628140-180628162 TTTTTAAAGAAGGAGAAGAATGG + Intergenic
984570907 4:181392385-181392407 TATTTTAAGAAGGGAAAGGAGGG + Intergenic
985140944 4:186840385-186840407 TCATTGAAGGAGGAGAAGGAGGG - Intergenic
985447418 4:190032413-190032435 TGTTTTATGTAGAAGAATGAGGG - Intergenic
985968133 5:3353171-3353193 TCTTTTATTAGGGAGTGGGAGGG + Intergenic
986094922 5:4545046-4545068 TCTTTAAAAAGGGAGAAGGAAGG - Intergenic
986294462 5:6425909-6425931 TTTCTTGTGAAGGAGAAAGATGG - Intergenic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
987792962 5:22592294-22592316 ACTTTGGTGAAGGAGAAGGCTGG - Intronic
988001688 5:25358127-25358149 CCTCTTCTGAAGCAGAAGGAAGG - Intergenic
988485526 5:31665411-31665433 TCTTTTATGGAGGCAAAGAAAGG + Intronic
988695279 5:33615699-33615721 TCTTTTAGCAAGGAGCAGGGAGG - Intronic
988821579 5:34891475-34891497 TCTGTGAAGAAGGGGAAGGAAGG - Intronic
989146220 5:38252684-38252706 TGTTTCCTGAAGGGGAAGGAAGG - Intergenic
990331269 5:54728297-54728319 TTTTTTAAGAAGGATAAGGAGGG + Intergenic
990612202 5:57468817-57468839 TTTTTTTTGAGGGAGGAGGATGG - Intergenic
990943572 5:61228147-61228169 TCTGTTAGGAAGAGGAAGGAGGG + Intergenic
991660162 5:68943035-68943057 TCTTTTTAGAAGAAGAAGAATGG - Intergenic
991776517 5:70090549-70090571 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991855804 5:70965996-70966018 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991869819 5:71098774-71098796 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991976511 5:72188600-72188622 TATTTAAAGAAGGGGAAGGAGGG - Intronic
992539857 5:77753511-77753533 TCTTTTATGAAGGCCTGGGATGG - Intronic
993066875 5:83111895-83111917 TCATTTCTGAAGGAGAGGGAAGG + Intronic
993154877 5:84209491-84209513 TCTTGTGGGATGGAGAAGGAAGG - Intronic
994144536 5:96379340-96379362 TGTTTTATAAATGAGAATGAGGG + Intergenic
994226111 5:97253570-97253592 CCTTTTCTCAAGCAGAAGGAAGG - Intergenic
994306871 5:98215403-98215425 ACATTTATAAAGGAGAGGGAGGG + Intergenic
994529920 5:100956427-100956449 TCTTTCCTCAAGCAGAAGGAAGG - Intergenic
994975852 5:106804512-106804534 TATTTCATGAAAGAGAAAGATGG + Intergenic
995133312 5:108653857-108653879 TGTTTTTTAAAGGAAAAGGAAGG - Intergenic
995495931 5:112743218-112743240 TCTTTTAAGAAGGAGGCAGAAGG - Intronic
996557092 5:124789422-124789444 TCTTTAATGAAAGTGTAGGATGG + Intergenic
996597395 5:125221559-125221581 GCTTTTAAGAAACAGAAGGAAGG - Intergenic
996660562 5:125997617-125997639 TTTTTTATGAAGTGTAAGGAAGG - Intergenic
997008409 5:129848044-129848066 TCTTTTAAGAAGGTTCAGGATGG + Intergenic
997212503 5:132085760-132085782 GCTGATATGAAGGAGATGGATGG - Intergenic
997567020 5:134895906-134895928 TCTTTTTTGAGGGACAGGGATGG + Intronic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
998463348 5:142325044-142325066 TTTTTTATGAATGGGAGGGAAGG + Intronic
1000184346 5:158844199-158844221 TTTTTTTTGAGGGGGAAGGAAGG + Intronic
1002901639 6:1414898-1414920 CCATTCATGAAGAAGAAGGAGGG - Intergenic
1004400075 6:15280410-15280432 TTTTTAATGCAGGAGGAGGAAGG - Intronic
1005353086 6:24955684-24955706 TTTTTTTTGAAGGAGCAGCATGG - Intronic
1005768773 6:29042983-29043005 TCTTTTGTGAAGGAGGAGAAGGG - Intergenic
1006428009 6:33978153-33978175 TTATTTGTGAAGGAGGAGGAAGG + Intergenic
1006708790 6:36047162-36047184 TCTTTTATGTGAGATAAGGAAGG + Intronic
1006909691 6:37555833-37555855 TCATTTTTGCAGGAGAAGGTGGG + Intergenic
1007473449 6:42104992-42105014 TCTTGTTCGAAGGAGAAGGTGGG + Exonic
1007476287 6:42122059-42122081 CAGTTTATAAAGGAGAAGGATGG + Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1008642078 6:53474437-53474459 TCTCTTCTTAAGCAGAAGGAAGG + Intergenic
1008999371 6:57695930-57695952 TCTTTTGTGAAGGGGAAAGATGG + Intergenic
1009187859 6:60595335-60595357 TCTTTTGTGAAGGGGAAAGATGG + Intergenic
1009878715 6:69538623-69538645 ACTCTTATGAAAGAGATGGAAGG - Intergenic
1010987804 6:82445738-82445760 TCTTTTAAAAAGGAAAAAGAGGG - Intergenic
1011110939 6:83836137-83836159 TCTTTGCTGAATTAGAAGGATGG + Intergenic
1011394338 6:86890852-86890874 TCTTTTAAGAAGGAAAAGTAAGG - Intergenic
1012037257 6:94158179-94158201 TACTGTATGAAGGAGAAGGAGGG - Intergenic
1012740739 6:103013688-103013710 TTTTTTATAAAGTATAAGGAAGG + Intergenic
1012807392 6:103911709-103911731 ACTTTTAAGAAACAGAAGGAAGG + Intergenic
1012968713 6:105703710-105703732 TCTTTTATGATTGAGAAAAATGG + Intergenic
1013609769 6:111783712-111783734 TCTTTTGGGAAGAAGAAAGAGGG - Intronic
1014033317 6:116735299-116735321 TCTTTTAAGAAGGAGCATTATGG + Exonic
1014521424 6:122447813-122447835 TCTTTTATAAAGAAGAAAGTAGG + Intronic
1015036237 6:128658114-128658136 TCTTGTGGGATGGAGAAGGAAGG + Intergenic
1015053400 6:128869781-128869803 GCTTTTATTATGGGGAAGGAGGG - Intergenic
1015464549 6:133534151-133534173 TCTTTTATGAAAGGGAAAAAGGG - Intergenic
1015473313 6:133631410-133631432 TCTTTCCTGGTGGAGAAGGAGGG - Intergenic
1016138945 6:140584529-140584551 TCTCTTATGAATGAAAAGTACGG + Intergenic
1016688774 6:146911694-146911716 TCTTTTATGAAGTAGAATGTTGG - Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1016896627 6:149060064-149060086 CCTTTGATGAAAGAGAATGAAGG - Intronic
1017042696 6:150320303-150320325 TCTCTTATGAAGTGCAAGGAAGG - Intergenic
1017243494 6:152196682-152196704 TCTTTTCTCAAGCAGAAGGAAGG + Intronic
1017732289 6:157327447-157327469 TCTTATATCAAGCAGCAGGAAGG - Intergenic
1017752475 6:157500740-157500762 CCTTTCATGAAAGTGAAGGATGG + Intronic
1017999437 6:159565886-159565908 TCTTTGATGTACTAGAAGGATGG - Intergenic
1018488185 6:164263668-164263690 CCTTTTTGGGAGGAGAAGGAAGG + Intergenic
1018884105 6:167918035-167918057 TTCTTTTTGAAGGAGAAGGAGGG + Intronic
1019157432 6:170048730-170048752 TCTTTTTGGAAGGAGGAGGGAGG - Intergenic
1019621293 7:1993577-1993599 TGTTTTTTGGAGGAGAAGCAGGG + Intronic
1022027736 7:26464629-26464651 GCTTGTGTGAAGGAGGAGGAGGG + Intergenic
1022268170 7:28779405-28779427 TCTTAGATAAAGGAGAAGGGAGG + Intronic
1023318296 7:38964861-38964883 TCTTTTATTACTCAGAAGGAAGG - Intergenic
1023558132 7:41444719-41444741 TCTTTTTTGGAGGACAAGGTTGG - Intergenic
1024307860 7:47943274-47943296 GCTTTTAAGAAACAGAAGGAAGG - Intronic
1024439397 7:49398520-49398542 GCTCTGATGAGGGAGAAGGAAGG - Intergenic
1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG + Intronic
1026242239 7:68586450-68586472 TCTTTGCTGATGCAGAAGGAAGG + Intergenic
1027714089 7:81647443-81647465 TATTTTCTGGAGAAGAAGGAAGG + Intergenic
1027827227 7:83131396-83131418 TGATTAATGAAGGAGAAAGAGGG + Intronic
1027925421 7:84455190-84455212 TTTTTTATGAAGTTGAGGGATGG + Intronic
1028026876 7:85854132-85854154 TGTTTGAAGAAGGAAAAGGAGGG - Intergenic
1028163294 7:87509893-87509915 TCTTAACTGAAGAAGAAGGAGGG + Intronic
1028467865 7:91173048-91173070 TCTTTGGTAAAGGAGAAGAAAGG - Intronic
1030394386 7:108967187-108967209 TCTTCACTGAAAGAGAAGGAAGG - Intergenic
1030488698 7:110204413-110204435 TCTTCTCTCAAGGAGAAGGCAGG + Intergenic
1031380856 7:121084323-121084345 TCTTTTATAAAGGAAAATTAAGG + Intronic
1031487476 7:122345681-122345703 TCTGTTGTGAAGGAAAAGCAGGG + Exonic
1031780717 7:125959844-125959866 TCTTTTATCAAAGAGAAGTTAGG - Intergenic
1032294692 7:130625887-130625909 CCTTTTATCAATGAAAAGGAAGG - Intronic
1032654723 7:133915464-133915486 TCTTATCTGACAGAGAAGGAAGG - Intronic
1032995256 7:137439018-137439040 TTATTTCTGAAGGAGAGGGAAGG + Intronic
1034037125 7:147836514-147836536 TCTATTATAAAGGGGCAGGAGGG - Intronic
1034048056 7:147950755-147950777 GCTTTTAGGAAGAAAAAGGAAGG - Intronic
1034630012 7:152523555-152523577 TCTTGCAGGAAGGAGAAGAATGG - Intergenic
1035110347 7:156476351-156476373 TTTCTTTTGGAGGAGAAGGAAGG - Intergenic
1038522900 8:28248562-28248584 TGTCTTATGAAGGAGAAGTGCGG + Intergenic
1039104335 8:33973932-33973954 GCTTCTTTGAAGAAGAAGGAAGG - Intergenic
1039302048 8:36220181-36220203 TCATTCAGGAAGCAGAAGGAAGG - Intergenic
1039451205 8:37676363-37676385 TCTCCTGTGAGGGAGAAGGAAGG - Intergenic
1041868292 8:62602508-62602530 TGTTTTATGAAACAGAAAGAGGG - Intronic
1042250148 8:66748221-66748243 TCTTCTAAGAATGAGAAGAAAGG - Intronic
1042744347 8:72090654-72090676 TCTTTTATTCAGTAGGAGGATGG - Intronic
1042962476 8:74319271-74319293 TCTTTTAAGAAGGCCAGGGATGG - Intronic
1043645987 8:82519249-82519271 GTTTTTATAAAGGAAAAGGAGGG - Intergenic
1044360994 8:91283420-91283442 TCTTTTATGAACAAGAGGAATGG - Intronic
1044931132 8:97252707-97252729 TCTTCTAAGCAGGAGAAGGATGG - Intergenic
1045420343 8:102008513-102008535 GCTTTTAAGAAACAGAAGGAAGG - Intronic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045982396 8:108206072-108206094 ATATTTATGAAGGAGAATGATGG - Intronic
1046344213 8:112901623-112901645 TCATTTAAGTGGGAGAAGGAAGG - Intronic
1046374612 8:113360329-113360351 TATTTTATCAAGTATAAGGAAGG + Intronic
1046573055 8:115991009-115991031 TGGTTTATGAAAGAGAGGGAGGG + Intergenic
1046818979 8:118616002-118616024 TGTTTTAGGAAGGAGAATGACGG - Intronic
1047164387 8:122420947-122420969 CATTTTATGATGGAGAAGAAAGG + Intergenic
1047615786 8:126561539-126561561 TCTTTTATAAAGGAGAAGAAAGG + Intergenic
1048403458 8:134094725-134094747 TCTTTCATGAAGATGAAGAAGGG - Intergenic
1048823281 8:138399024-138399046 TCTTTTATTAATGAGAAGACAGG - Intronic
1049035295 8:140070930-140070952 TCTGTTGTGAAGCAGAGGGACGG + Intronic
1049456645 8:142695237-142695259 TCTTTTTTGATGGGGAGGGATGG - Intergenic
1049459706 8:142720276-142720298 CATTTTATAAAGGATAAGGATGG - Intergenic
1049935746 9:500068-500090 GCTTTTAAGAAACAGAAGGAAGG + Intronic
1050489833 9:6176837-6176859 GCTTGTAAGAAGGAGAAAGAGGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050871009 9:10570143-10570165 TGATTTGTGAAGGAGAAAGATGG - Intronic
1051130631 9:13856279-13856301 TCATCTATGAATGAGAAGGCAGG - Intergenic
1051526571 9:18051396-18051418 TCTTCCATGAAGGGGAAGGTAGG + Intergenic
1052391494 9:27883478-27883500 TCTAATATGAAGGAGATGAATGG - Intergenic
1052807692 9:33026949-33026971 TGTTTTTTGGAGGAGGAGGAAGG + Exonic
1053412442 9:37924471-37924493 ATATTTATGCAGGAGAAGGATGG + Intronic
1053548632 9:39051038-39051060 TTTTTTATATAGGATAAGGAAGG - Intergenic
1055068369 9:72142180-72142202 TCTTTGATGAATGAGAAGTGGGG + Intronic
1055580024 9:77698675-77698697 TCTCTTCTCAAGCAGAAGGAAGG + Intergenic
1055904458 9:81276668-81276690 TCTTTTATGAAAGAAAACCATGG + Intergenic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1056471085 9:86904886-86904908 TCATTAGGGAAGGAGAAGGAAGG - Intergenic
1056479631 9:86988027-86988049 TCTAATATGAAGGAGTAGGGGGG + Intergenic
1056562448 9:87743453-87743475 TATTTTATAAAGGAAAAGAAAGG - Intergenic
1057465518 9:95310752-95310774 TCTGTTATGACAGAGAAGGGAGG + Intronic
1058412537 9:104748625-104748647 TCCTTTCTGAAGGGGCAGGATGG + Intronic
1058467022 9:105238919-105238941 TATTTTATTAAGGACAGGGAGGG - Intergenic
1058841168 9:108910947-108910969 GCTTTTATGTAGGAGTAGAAGGG + Intronic
1059868200 9:118540926-118540948 ACTTTCATGAATTAGAAGGATGG - Intergenic
1060570002 9:124629672-124629694 TCTTCTAGGAAGGCAAAGGAAGG - Intronic
1203793816 EBV:165565-165587 GGTGTTATGAAGGAAAAGGATGG + Intergenic
1203441171 Un_GL000219v1:9927-9949 TGTTTTATGTAGAAGAAGAAGGG - Intergenic
1203511980 Un_KI270741v1:128835-128857 TGTTTTATGTAGAAGAAGAAGGG - Intergenic
1186317783 X:8389177-8389199 TCTTCTCTGTTGGAGAAGGAGGG + Intergenic
1186374283 X:8981614-8981636 TCTTTGATGGGGGAGCAGGACGG + Intergenic
1186607218 X:11104983-11105005 TCTTTTAAAAAGGAGGAGCATGG - Intergenic
1187231572 X:17428544-17428566 TCTTTATTAAAGGAGGAGGAAGG + Intronic
1188414831 X:29920071-29920093 TCGTTTATGAAGGAGAACGCTGG - Exonic
1191693618 X:63965589-63965611 TATCCTATGAAGGAGAAGGTAGG - Intergenic
1191991281 X:67039357-67039379 TCTATTCTCAAGCAGAAGGAAGG + Intergenic
1192721977 X:73708745-73708767 TCTTTCATGCATGAAAAGGAAGG + Intergenic
1193540410 X:82764857-82764879 CCTTTGACGAAGGAAAAGGAAGG - Intergenic
1193661008 X:84258354-84258376 GCACTTATGAAGGAGAATGAGGG + Intergenic
1193744749 X:85263353-85263375 TCTTTTAATAAGGAAAAAGAGGG + Intronic
1194320527 X:92441032-92441054 TCTTTTAGCAAAGAGACGGATGG + Intronic
1194867934 X:99091802-99091824 TCTTTTCAGAAGGTGAAGGGTGG + Intergenic
1195706671 X:107742630-107742652 CCTTTTATGAAGGAGGGTGAAGG - Intronic
1196461435 X:115935809-115935831 TCTCTCATCAAGCAGAAGGAAGG + Intergenic
1196938403 X:120752279-120752301 TCTTTTCTGAAGGAGTGGAATGG + Intergenic
1197434337 X:126407268-126407290 TCTTTTGTGAGGCAGAAAGATGG - Intergenic
1197644982 X:129007566-129007588 GTATTTATGAAGGAGTAGGAAGG + Intergenic
1197706622 X:129639026-129639048 TCTTTTAGGAAGCAGAAGCAGGG - Intergenic
1198000218 X:132426619-132426641 TCTTTGAAGAAGGAATAGGAAGG - Intronic
1198479172 X:137024929-137024951 TCCTTTTTAATGGAGAAGGATGG + Intergenic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic
1199274581 X:145926224-145926246 TCTCTTCTCAAAGAGAAGGAAGG - Intergenic
1199467107 X:148150720-148150742 TCTTTTATTGAGGAAGAGGAAGG + Intergenic
1200409126 Y:2844388-2844410 TCCTTTCAGAAGGAGAATGAGGG + Intronic
1200628640 Y:5554160-5554182 TCTTTTAGCAAAGAGATGGATGG + Intronic
1200735986 Y:6796077-6796099 TTTTGTATGAAGCATAAGGAAGG + Intergenic
1201651952 Y:16298410-16298432 TGTTTTATACAGGAGAAAGAAGG + Intergenic
1202048814 Y:20760177-20760199 TCATTTCAGAAGGAGAATGAGGG + Intronic
1202264180 Y:23000726-23000748 CCTTTTATGAAGGCCCAGGAAGG - Intronic
1202417172 Y:24634468-24634490 CCTTTTATGAAGGCCCAGGAAGG - Intronic
1202453615 Y:25035618-25035640 CCTTTTATGAAGGCCCAGGAAGG + Intronic