ID: 1024609569

View in Genome Browser
Species Human (GRCh38)
Location 7:51052990-51053012
Sequence CAGCTCGGTCCTGCCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024609569 Original CRISPR CAGCTCGGTCCTGCCTTCTT GGG (reversed) Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900264130 1:1748994-1749016 TAGCTCTGTCCTGCCCCCTTCGG + Intergenic
900596968 1:3484327-3484349 CGGCTCGGTCCTCCCTTCTCCGG + Intergenic
900604877 1:3519494-3519516 CAGCTCCGACCTGCCCTCCTGGG + Intronic
900824460 1:4914704-4914726 CAGCTGTGTCCTGTGTTCTTAGG - Intergenic
906529750 1:46517013-46517035 CTGCTCAGTCCTGGCTGCTTTGG + Intergenic
907943068 1:59107590-59107612 CAGCTTGGTTCTGCCTTGTTGGG + Intergenic
913174455 1:116261506-116261528 ATGCTCGGTCCCGCCTTCTCAGG - Intergenic
914801611 1:150966576-150966598 GAGCTCTATCCTGCCTTCTTTGG - Exonic
919761333 1:201099962-201099984 AGGCTGGGTCCTGCTTTCTTGGG - Intronic
919807304 1:201387768-201387790 CAGCCCTGTTCTCCCTTCTTGGG + Intronic
922607196 1:226897027-226897049 CTCCTCTGTCCTTCCTTCTTAGG - Intergenic
922885836 1:229019836-229019858 CTTCCCCGTCCTGCCTTCTTGGG + Intergenic
922988023 1:229881237-229881259 CAGCTCACTCCTGCCTTCTCTGG - Intergenic
1063802546 10:9596494-9596516 CAGTACCCTCCTGCCTTCTTCGG - Intergenic
1063890576 10:10623962-10623984 CAGATGGGCCCTCCCTTCTTGGG - Intergenic
1067725506 10:48767912-48767934 CAGCTTGGTCCTGACTTTCTGGG - Intronic
1068942702 10:62695474-62695496 CACCCCGACCCTGCCTTCTTGGG + Intergenic
1069638432 10:69939916-69939938 CAGCTCGTTGCCTCCTTCTTGGG + Intronic
1070795400 10:79213393-79213415 GAGCACGGTCCTGCCCTCTCTGG + Intronic
1075641650 10:124069143-124069165 CAGCACAGACCTGCCTCCTTGGG - Intronic
1077072261 11:680754-680776 CAGCTCGGTCTTGCTTCCCTGGG - Intronic
1077444727 11:2585676-2585698 CAGCTGGGTCCTACCTCCCTTGG - Intronic
1078576314 11:12505540-12505562 CACCTCGGCCCTGCCTGCTGAGG + Intronic
1079793244 11:24765969-24765991 CAGGTGGGTCTTGCATTCTTGGG + Intronic
1081429232 11:42957556-42957578 CGGCCAGGTCCTGCCTTTTTAGG - Intergenic
1083318265 11:61829204-61829226 AAGCTCGAGCCGGCCTTCTTGGG + Intronic
1084547526 11:69821916-69821938 CAGCCCGGTCCTTCCATCTGCGG + Intergenic
1084663685 11:70563496-70563518 CAGCTAAGTCCTTCCTTCCTTGG + Intronic
1088583097 11:111334321-111334343 CAGCTGAGTCCTGGCTTCTGTGG - Intergenic
1089371914 11:117966881-117966903 CAGCTCTGTGCTGGCTTCCTTGG + Intergenic
1091367288 11:135032833-135032855 CAGCATGGTCCTGCCTGCATGGG - Intergenic
1101399691 12:104376766-104376788 TAGCCCGGTCCTGCCTTTTGTGG - Intergenic
1103940209 12:124497267-124497289 CACCTCGGTCCTGCCTGCGTGGG + Intronic
1104081693 12:125435285-125435307 CAGCTCTCATCTGCCTTCTTTGG - Intronic
1107262624 13:38513344-38513366 CACTTCTTTCCTGCCTTCTTTGG - Intergenic
1113588970 13:111484777-111484799 CAGCCGGGTACTGCCTGCTTGGG - Intergenic
1114526845 14:23371878-23371900 CAGCCGGGTCCAGCCTGCTTGGG - Intergenic
1122043524 14:99007404-99007426 CAGCTCGGCCCCTCCTTCTGAGG + Intergenic
1125417315 15:39467160-39467182 CTGCTCTTTCCTACCTTCTTTGG + Intergenic
1126701287 15:51370191-51370213 CAGCTACTCCCTGCCTTCTTTGG + Intronic
1130547949 15:84870027-84870049 CAGCTCTGTGCTTCCTTCCTGGG - Exonic
1132439263 15:101842288-101842310 CAGCTCTGTTCTGCTTTCTGTGG + Intergenic
1135995244 16:27243085-27243107 CAGAGCAGTGCTGCCTTCTTTGG - Intronic
1137756004 16:50902770-50902792 CGGCTGGGACCTGCCTTCCTTGG + Intergenic
1138577343 16:57916380-57916402 CAGCTAGATCCTGATTTCTTGGG + Intronic
1140035465 16:71368161-71368183 CAGCTAGGTCCTGCCATGGTGGG - Intronic
1140756769 16:78074644-78074666 CAGCTTGGTTCTTGCTTCTTGGG + Intergenic
1141533609 16:84663503-84663525 CAGCTCATTCATGCCTTCCTTGG - Intronic
1142150184 16:88509280-88509302 CAGCTGGGTCCAGCTTTGTTGGG - Intronic
1142877415 17:2860229-2860251 CAGCTGGGTCCTGCCCTTTCTGG + Intronic
1143608349 17:8003466-8003488 CAGCGCGATCCCGGCTTCTTCGG - Exonic
1144830572 17:18128775-18128797 CACCTCACTCCTCCCTTCTTAGG - Intronic
1146529460 17:33595872-33595894 CAGCTGTGTCTTGCCTTCTCTGG + Intronic
1147584984 17:41648810-41648832 CAGCTCAGTGCTGCCCTCTGGGG - Intergenic
1147793332 17:43026268-43026290 CAGCTGGGTCCTGCCTACCTGGG + Intronic
1149541825 17:57473247-57473269 AAGCTCGGGGCTGCCTGCTTGGG + Intronic
1151683711 17:75634945-75634967 CAGCCGGGTCCTGCTTCCTTAGG - Intronic
1151969795 17:77451660-77451682 CCGCTCGGTCCTGCCGGCCTCGG - Intronic
1152185904 17:78856148-78856170 CAGCTTGGCCCTGCCCTCTGGGG + Intronic
1156262536 18:35458813-35458835 CACCTGGCTCCTGCCTTCTGGGG - Intronic
1157169895 18:45393587-45393609 CAGCTCCCTCCCACCTTCTTGGG - Intronic
1164506700 19:28867034-28867056 CAGCCAGGACCTGCGTTCTTTGG - Intergenic
927519698 2:23691285-23691307 CAGCCCGGCCCTGCCTGCCTTGG - Intronic
930854024 2:55993255-55993277 CAGCTTGGACCTACCTTCTCTGG + Intergenic
931704581 2:64936946-64936968 CAGCCCAGTCCTGACTTCTCTGG + Intergenic
942402754 2:175621021-175621043 CAGCTTGGTCCTGTCTGCCTAGG - Intergenic
943366565 2:186972521-186972543 GAGCTTGGTGCTTCCTTCTTTGG - Intergenic
947867603 2:233410394-233410416 CAGCTCTGCGCTGCCTTCTGAGG + Intronic
948710359 2:239821456-239821478 CAGATCCGTGCTGCCTCCTTGGG - Intergenic
1172029029 20:31968624-31968646 CGGCTCGGGGCTGCCTTCTTTGG - Exonic
1173041549 20:39468857-39468879 CACCTCTGTCCTTGCTTCTTTGG + Intergenic
1173706741 20:45115568-45115590 CAGCCTGGGCCAGCCTTCTTTGG - Intergenic
1173828038 20:46059483-46059505 CAGCCAGGTCCTGCCTTCTGGGG + Intronic
1174457456 20:50659782-50659804 CAGCTGAGTCCTGACTTCTCTGG + Intronic
1175927650 20:62478915-62478937 CAGCCCTGTCCTGCCTTGTGTGG - Intergenic
1182060250 22:27392332-27392354 CAGGGTGGTGCTGCCTTCTTGGG - Intergenic
1182338822 22:29603398-29603420 CCGCTCCGTCCCGCCTCCTTTGG - Intergenic
1184152749 22:42648230-42648252 CACCTGGGTCCTCCCTCCTTGGG - Intronic
1184208891 22:43023645-43023667 CAGCTTGGACCTGCCATCTGTGG - Intergenic
1184714267 22:46271916-46271938 CAGCCAGGTTATGCCTTCTTTGG + Intronic
1184795932 22:46732350-46732372 CAGCTGAGTCCTGCCTTTTGAGG - Intronic
1185013824 22:48332026-48332048 CAGCTGGGTCCTGCCCTCCATGG - Intergenic
1185163283 22:49242619-49242641 CAGCTGAGTCATGCCTTCCTGGG - Intergenic
954198066 3:49007901-49007923 CAGCTCGGCCCCGTCTCCTTCGG - Intronic
954275103 3:49536793-49536815 CAGCTCTGCCCTGCCTCTTTTGG + Intergenic
955444630 3:58996733-58996755 CAGCACTCTCCTTCCTTCTTTGG - Intronic
956334562 3:68148723-68148745 CAGCTCTGCTCAGCCTTCTTTGG + Intronic
961021502 3:123511309-123511331 CAGCTCTGACTTGTCTTCTTGGG + Intronic
964752962 3:160069043-160069065 GAGCTTGGTGCTTCCTTCTTTGG - Intergenic
968865618 4:3209447-3209469 AGGTTCAGTCCTGCCTTCTTAGG + Intronic
968963924 4:3759931-3759953 CAGCTCAATTCTGCCTCCTTTGG - Intergenic
969955531 4:10886344-10886366 AAGCTCAGTCCTTACTTCTTGGG + Intergenic
971428108 4:26535699-26535721 CAGCTTGGTCCTGCTGTCTCAGG - Intergenic
980648729 4:135681696-135681718 CAGCACAGTACTGCCTTCTTTGG - Intergenic
984051128 4:174866561-174866583 CAGCTAGGTCCTGCTTTCAGTGG - Intronic
986238372 5:5933834-5933856 CTGCTCAGTGCTGCCTCCTTAGG + Intergenic
990729634 5:58794459-58794481 GAGCTTGGTCATGCCTGCTTCGG - Intronic
991005087 5:61821045-61821067 CAGCTGGCTGCTGCCTTCCTGGG + Intergenic
991140418 5:63234374-63234396 CAGCTCTTTCTTTCCTTCTTGGG + Intergenic
995217453 5:109612004-109612026 AAGCTTGGTCCTGACTTCTGAGG + Intergenic
995434343 5:112119055-112119077 CTGCTACGTCCTGCCTTCTCTGG + Intergenic
999856223 5:155597167-155597189 CAGCTGTGCCCTGCCTTCTCAGG - Intergenic
1003505068 6:6734003-6734025 CTGCTCGCTCCTGCCTTCACTGG + Intergenic
1003858860 6:10303597-10303619 CAGCTCTGTCTTGTTTTCTTCGG + Intergenic
1005231901 6:23711352-23711374 CAGCTGGGTCCTGGAGTCTTAGG - Intergenic
1011293136 6:85798181-85798203 CAGCCAGTTCCTGCCTTCCTTGG + Intergenic
1012799758 6:103810276-103810298 CGTCTCAGTCCAGCCTTCTTGGG - Intergenic
1012831879 6:104214107-104214129 CATCTCAGTCCTCCCTTTTTTGG - Intergenic
1016830021 6:148424798-148424820 CAGCTCTGAGCAGCCTTCTTTGG + Intronic
1017524249 6:155228927-155228949 CAGCTCTGACCTGCCTTCCTGGG + Intronic
1019703683 7:2487558-2487580 CATCTGGGTCCTGCCTTTTGAGG - Intergenic
1020091528 7:5344850-5344872 CATCAGGGCCCTGCCTTCTTGGG - Intronic
1022097972 7:27152548-27152570 CCGCTCCGTCCTGCCTGCTTCGG - Intronic
1022501195 7:30883317-30883339 CACCCCTGTCCTGCCTCCTTCGG - Intronic
1024109685 7:46132594-46132616 CAGCTCTGTGCTGCTTTCTCAGG - Intergenic
1024609569 7:51052990-51053012 CAGCTCGGTCCTGCCTTCTTGGG - Intronic
1028414002 7:90560407-90560429 CAGCTCACTGCAGCCTTCTTTGG - Intronic
1029196757 7:98810835-98810857 CAGCTCTGCCCTGCCTTGTTGGG - Intergenic
1029402382 7:100354088-100354110 GAGATCTGTCCTGGCTTCTTGGG + Intronic
1030124836 7:106143903-106143925 CAGCTTGGCCTTGCCTTCTGGGG + Intergenic
1030789683 7:113708253-113708275 CAGCTTCTTCCTGCCCTCTTAGG - Intergenic
1031403724 7:121357243-121357265 CAGCTGGGTCCTGCTTTCTCTGG + Intronic
1034353905 7:150435630-150435652 CAGCCAGGCCCTGCCTTCCTGGG + Intergenic
1038111858 8:24509017-24509039 CCGCTCTGCCCTGCCTTCTTTGG - Exonic
1040433757 8:47369502-47369524 CTGCTGGGTACTGCCCTCTTTGG + Intronic
1041767803 8:61437578-61437600 CATATTGGTCCTGCCTTATTAGG - Intronic
1045966294 8:108028591-108028613 CAGCTCTCTCCATCCTTCTTAGG + Intronic
1049277111 8:141725413-141725435 CAGCTGTTTCCTGCCTTCCTTGG + Intergenic
1049690064 8:143954388-143954410 CAGGTCGGACCTGTCATCTTTGG - Intronic
1052641100 9:31166593-31166615 CAGCTCTGTCCTGCCTCACTTGG - Intergenic
1055961916 9:81828737-81828759 TAGCTCCTTCCTGCCTTCTATGG - Intergenic
1056319209 9:85420809-85420831 CAGCTCGGGACTGCATTCCTGGG - Intergenic
1057517850 9:95737091-95737113 CAGCCCTGTCCTGGCTTCCTGGG - Intergenic
1057849087 9:98550724-98550746 AAGCTCTGCCCTGCCTGCTTTGG + Intronic
1058905415 9:109478577-109478599 CATCTCGTTCCTCCTTTCTTTGG - Intronic
1059798012 9:117720743-117720765 CAGGTCAGTCCTGCCTTGCTTGG - Intergenic
1060149643 9:121280099-121280121 CTGCACGGCCCTGCCATCTTCGG + Intronic
1060829626 9:126705525-126705547 GTCCTCGCTCCTGCCTTCTTTGG - Intergenic
1061002857 9:127912210-127912232 CAGCTGGGGCCTTCCTTCTCTGG - Intronic
1062266366 9:135688203-135688225 CAGCCCTGTCCTGCCCTCTGTGG - Intergenic
1185567966 X:1110092-1110114 CCCCTCGGTCCTGCCTCCTGGGG - Intergenic
1189274937 X:39778730-39778752 CAGCCCTGGCCTGCCTTCTCTGG - Intergenic
1192184338 X:68936503-68936525 CAGCTCTCTCCTCCCTTCTCTGG - Intergenic