ID: 1024610198

View in Genome Browser
Species Human (GRCh38)
Location 7:51057778-51057800
Sequence GATGCTGGGGCTCCAGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024610192_1024610198 5 Left 1024610192 7:51057750-51057772 CCACCAACACTCAAAATAACCTA 0: 1
1: 0
2: 1
3: 18
4: 314
Right 1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG 0: 1
1: 0
2: 0
3: 31
4: 300
1024610190_1024610198 17 Left 1024610190 7:51057738-51057760 CCTCAGCAAAACCCACCAACACT 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG 0: 1
1: 0
2: 0
3: 31
4: 300
1024610193_1024610198 2 Left 1024610193 7:51057753-51057775 CCAACACTCAAAATAACCTACAT 0: 1
1: 0
2: 2
3: 25
4: 292
Right 1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG 0: 1
1: 0
2: 0
3: 31
4: 300
1024610191_1024610198 6 Left 1024610191 7:51057749-51057771 CCCACCAACACTCAAAATAACCT 0: 1
1: 0
2: 1
3: 19
4: 234
Right 1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG 0: 1
1: 0
2: 0
3: 31
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024610198 Original CRISPR GATGCTGGGGCTCCAGCCTT AGG Intronic
900370236 1:2329006-2329028 GATTCTTGGGCCCAAGCCTTGGG + Intronic
901441048 1:9278726-9278748 GATGCCGTGGCTGCAGCATTGGG + Intergenic
901448765 1:9323702-9323724 GATTCTGGGGATTCAGCCTTTGG + Intronic
901722450 1:11210407-11210429 GGTGCGGTGGCTCCCGCCTTGGG - Intronic
901840388 1:11950459-11950481 GATACTTGGTCTCCAGCCTGCGG - Exonic
902704627 1:18196084-18196106 GAGGCTGGGGCTTCATCCTGGGG + Intronic
903276264 1:22223875-22223897 GGTGCTTGGGCTCTAGCCTGAGG - Intergenic
903277772 1:22232774-22232796 ACTCCTGGGGCTCCAGCCTTTGG + Intergenic
903281659 1:22253610-22253632 GAGGCTGCAGCTCCAGCCTTGGG + Intergenic
904603380 1:31685655-31685677 GAACCTGGGCCTCCAGGCTTTGG - Exonic
905177752 1:36148629-36148651 GGGGCTGGGGCTGCAGACTTAGG - Intronic
905422979 1:37860624-37860646 GATTTTGTGGCTCAAGCCTTGGG - Intergenic
905458726 1:38106759-38106781 GGAACTGGGGCTGCAGCCTTGGG + Intergenic
909917941 1:81343799-81343821 ATTGCTGGGGCTCCACCTTTAGG + Intronic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
915012318 1:152699050-152699072 GCTGCTGCGGCTCCAGCTCTGGG + Exonic
915020738 1:152776520-152776542 GCTGCTGTGGCTCCAGCTCTGGG + Exonic
915021932 1:152787448-152787470 GCTGCTGTGGCTCCAGCTCTGGG + Exonic
915022894 1:152797931-152797953 GCTGCTGTGGCTCCAGCTCTGGG + Exonic
915023605 1:152805308-152805330 GCTGCTGTGGCTCCAGCTCTGGG - Exonic
915024261 1:152812595-152812617 GCTGCTGTGGCTCCAGCTCTGGG + Exonic
915024267 1:152812619-152812641 GAAGCTGTGGCTCCAGCTCTGGG + Exonic
915025702 1:152827621-152827643 GCTGCTGTGGCTCCAGCTCTGGG + Exonic
915076278 1:153310611-153310633 CATTCTGGGTCTCCAGGCTTGGG - Exonic
915506180 1:156357762-156357784 GATGCTGGAGAGCCAGCCTGTGG - Intronic
916025915 1:160833398-160833420 CACACTGTGGCTCCAGCCTTGGG + Intronic
916149006 1:161767688-161767710 GATGCTAGGGGTACAGACTTTGG - Intronic
916818581 1:168376295-168376317 GATTCTGGGGCCACAGACTTGGG + Intergenic
917797867 1:178544694-178544716 GGTGCTGGGGATCCAGCCCGTGG - Intronic
920525604 1:206663846-206663868 GACGAAGGGGCTGCAGCCTTTGG + Intronic
920647441 1:207813950-207813972 AAAGCTGTGGCTGCAGCCTTAGG + Intergenic
921264679 1:213412383-213412405 CATGCTGGGGGCCCAGCCTGAGG + Intergenic
921291801 1:213664265-213664287 GCTGCTGAGGCTCCGGCCTCAGG + Intergenic
922331818 1:224583660-224583682 AATGCTGGGGCTCCTACCATTGG + Intronic
922793076 1:228321338-228321360 GCTGCTGGGGCCCCAACCTGTGG - Exonic
1063361950 10:5466548-5466570 GAGGGTCGGGCTGCAGCCTTTGG + Intergenic
1065081795 10:22136484-22136506 GATGCTGGAGCTCTAGCTTTGGG - Intergenic
1067043845 10:42973596-42973618 GCTGTGGGGGCTGCAGCCTTTGG + Intergenic
1067163143 10:43843776-43843798 GATTCTTTGGCTCCAGTCTTTGG + Intergenic
1067236926 10:44458942-44458964 GCTGCTGATGCTCCAGCCTATGG + Intergenic
1067699348 10:48557599-48557621 AAGCCTGGGGCTCCAGCATTGGG - Intronic
1068941243 10:62683373-62683395 GATTCTGGGGCTCCAGTTTTGGG - Intergenic
1069958160 10:72064094-72064116 GACCCAGGGCCTCCAGCCTTGGG - Intronic
1072617745 10:97060598-97060620 GATGCTGGGGCACAGCCCTTTGG - Intronic
1072718086 10:97764915-97764937 GCTGCTGGGTCTCCAGCCAGCGG + Intergenic
1073300604 10:102469012-102469034 AAGGCTGGGGCTGCAGCCATGGG + Exonic
1074727233 10:116324443-116324465 GAAGCACTGGCTCCAGCCTTAGG + Exonic
1074776638 10:116772113-116772135 GATGATGGTGTTCCCGCCTTGGG + Intergenic
1076070385 10:127483988-127484010 GATGCTGCGTCTCCAGCATGGGG + Intergenic
1076222953 10:128749374-128749396 GAAGCTGGGGACCCAGCATTAGG + Intergenic
1076388131 10:130074090-130074112 GACGCTGGGCCGCCAGTCTTGGG + Intergenic
1076932102 10:133538414-133538436 GAAGCTGGGGCTCCAGCACTGGG - Intronic
1077124213 11:925338-925360 GAAGCTGGGGCTCCAGGCGAAGG - Intronic
1077256364 11:1585205-1585227 GAGGCTGTGGCTCCAGCTGTGGG - Exonic
1077259514 11:1608341-1608363 GAGGCTGTGGCTCCAGCTGTGGG - Exonic
1078107837 11:8369850-8369872 GATGCTAGGGCTTTAGCCTAAGG + Intergenic
1079622222 11:22567973-22567995 GTGGCTGCAGCTCCAGCCTTGGG - Intergenic
1081589389 11:44410488-44410510 GATGCTGTGGACCCAGGCTTGGG + Intergenic
1081638721 11:44738367-44738389 AAAGCTGGGGCTCCAGCCGGGGG - Intronic
1081930970 11:46871139-46871161 GATGCTGGGACCGCAGCATTAGG + Intronic
1082236742 11:49826623-49826645 GAAGCTGGGGCCGCAGCCTGTGG + Intergenic
1082240188 11:49861118-49861140 GAAGCTGGGGCCGCAGCCTGTGG + Intergenic
1082241958 11:49883078-49883100 GAAGCTGGGGCCACAGCCTGTGG - Intergenic
1083302547 11:61746506-61746528 CATGGTGTGGCTGCAGCCTTGGG - Exonic
1084548895 11:69828978-69829000 GGTGCTGGGGCCTCAGGCTTTGG + Intergenic
1085624783 11:78063737-78063759 GATGCTGGGGCCTGAGCCCTGGG + Intronic
1085677113 11:78533124-78533146 GGTGCTGGGGCTCCAGCTGTTGG - Intronic
1087044150 11:93830323-93830345 GCTGTTTAGGCTCCAGCCTTAGG - Intronic
1089171144 11:116512449-116512471 GAAGCTGGGGTTGGAGCCTTTGG - Intergenic
1089358339 11:117870307-117870329 CCTGCTGGGGCCCCAGCCTGTGG - Intronic
1090801297 11:130174151-130174173 GCTCCTGGGGCTGCAGCCTGTGG - Intronic
1090949782 11:131463473-131463495 GCCGCTGGGGCCCCAGGCTTGGG + Intronic
1091187773 11:133661997-133662019 GATGCTGGAACCCCAGTCTTTGG - Intergenic
1091830931 12:3550902-3550924 AATGCTTGTGCTCCAGCCCTGGG - Intronic
1093044263 12:14424333-14424355 GATGCCGGAGATCCAGCCTCCGG + Exonic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095888718 12:47215669-47215691 GAGGCTGGGGCTCAGGCCTGTGG + Intronic
1098035807 12:66301180-66301202 GATGCTTGGGATGGAGCCTTGGG + Intergenic
1100119760 12:91355541-91355563 GATGCTGGGGTTACAGACCTGGG + Intergenic
1103292408 12:119857657-119857679 GTTACAGGAGCTCCAGCCTTCGG - Exonic
1105245432 13:18645870-18645892 GCTTCTGGAGGTCCAGCCTTAGG + Intergenic
1105826767 13:24129909-24129931 GACCCTGGGGTCCCAGCCTTTGG + Intronic
1106686715 13:32067970-32067992 GATGCTGGTGCTGCTGCCCTGGG - Intronic
1107178357 13:37426152-37426174 TATGTTGGTGCTCCAGCATTAGG - Intergenic
1111463441 13:88576187-88576209 GCTGCTCTGGCTCCAGCCTTAGG - Intergenic
1112382577 13:98906198-98906220 AAGGCTGGAGTTCCAGCCTTGGG + Intronic
1113638530 13:111939456-111939478 GATGCTGGAGCCCCAGCCCAGGG - Intergenic
1113734899 13:112671579-112671601 ACTGCTGGGGCTCAAGCCCTGGG - Intronic
1113781385 13:112979567-112979589 GATGCTAGAGCCACAGCCTTCGG - Intronic
1113972787 13:114202765-114202787 GATGCTTAGCCTGCAGCCTTGGG + Intergenic
1114538045 14:23435566-23435588 GATAAGGGGGCTCCAGGCTTAGG - Intronic
1117086533 14:52207357-52207379 GATCCTGTTTCTCCAGCCTTTGG - Intergenic
1117452981 14:55869627-55869649 GATGATCTGTCTCCAGCCTTAGG + Intergenic
1117965339 14:61202120-61202142 GGGGCTGTGGTTCCAGCCTTTGG - Intronic
1118330914 14:64815346-64815368 GCTGCTTGGGCTGCAGCCCTCGG - Intronic
1119905515 14:78298234-78298256 CATGCCGGGGCTCCAGGCTGGGG + Intronic
1121271030 14:92638425-92638447 GATGCTGGGGTTCGAGTCTGGGG + Intronic
1122943944 14:104996532-104996554 CCTGCTGGGCCTCCAGACTTTGG - Intronic
1123795353 15:23765387-23765409 GATTCTGGAGCACCAGTCTTAGG + Intergenic
1123874197 15:24607259-24607281 GAGGCTTGGGCACAAGCCTTAGG + Intergenic
1124449235 15:29770325-29770347 GATTCTCGTGCTTCAGCCTTGGG - Intronic
1125894976 15:43294176-43294198 GAAGCTGGGACTTCAGCCATAGG + Intronic
1126852537 15:52805891-52805913 GATGCTGGAACTCAGGCCTTCGG + Intergenic
1127502091 15:59563426-59563448 GATTCTGGTGCCTCAGCCTTTGG + Intergenic
1127845064 15:62862719-62862741 GAATCTGGGGCTCCAGTGTTGGG - Intergenic
1128802100 15:70503512-70503534 GATGCTGAGGCTCCTGTCTCAGG + Intergenic
1129845981 15:78767915-78767937 GGGGTTGGGGCTTCAGCCTTGGG + Intronic
1129846233 15:78768860-78768882 GGGGCTGGGGCTTCAGCCTTGGG + Intronic
1129883898 15:79025550-79025572 GATGCTGGGGCAGCAGCAGTGGG + Intronic
1130242681 15:82211151-82211173 AATGCTGGGATTCCAGCTTTTGG - Intronic
1130255674 15:82325066-82325088 GGGTCTGGGGCTTCAGCCTTGGG - Intergenic
1130255893 15:82325948-82325970 GGGGTTGGGGCTTCAGCCTTGGG - Intergenic
1130457707 15:84129723-84129745 AATGCTGGGGTTCCAGCTTTTGG + Intergenic
1130542929 15:84835016-84835038 GAGGCTGAGGCCCCAGCCCTGGG + Intronic
1130547866 15:84869591-84869613 GATCCTGGGGCCCCAGCTCTGGG + Exonic
1130599066 15:85264038-85264060 GGGGTTGGGGCTTCAGCCTTGGG + Intergenic
1130599289 15:85264920-85264942 GGGGCTGGGGCTTCAGCCTTGGG + Intergenic
1132390278 15:101433644-101433666 GACCCTGGGTCGCCAGCCTTGGG - Intronic
1134747467 16:16599346-16599368 GAAGCTGGGGATCCAGGCTGGGG + Intergenic
1134850062 16:17471640-17471662 GAGGCTGCGGGGCCAGCCTTTGG - Intergenic
1135158235 16:20072570-20072592 TTTCCTGGGGCTCCAGCTTTGGG - Intronic
1137378661 16:47977169-47977191 GATGCCTGGGCTCCACCCCTAGG + Intergenic
1138347066 16:56326589-56326611 GCTGCTGGGGCTCCATCCCATGG + Intronic
1138626574 16:58256709-58256731 GATGATGGGGCTGGAGCCTGAGG + Intronic
1139761215 16:69186216-69186238 GATTCTGGGTCTCAGGCCTTTGG + Intronic
1141548326 16:84787100-84787122 GATTCTGGGCAGCCAGCCTTCGG + Intergenic
1142420493 16:89966714-89966736 GAGGCTGTGGCCCCAGCCTGAGG + Exonic
1142985762 17:3694761-3694783 GCTGCTGGGGCCCCACCCTCAGG + Intronic
1143037637 17:4008832-4008854 GATGGTGGCGCCCCAGCCTGGGG + Intronic
1143762423 17:9115047-9115069 GATGCTGGGGCGCCAGGCCGGGG + Intronic
1143950492 17:10628878-10628900 GTCGCTGGGTCTCCAGCGTTTGG - Intronic
1144720288 17:17464433-17464455 GATGCTGGTCCTCCTGTCTTTGG + Intergenic
1144785214 17:17827632-17827654 GCACCTGGGGCTCCAGCCATGGG - Intronic
1145288151 17:21521901-21521923 GATGCTGGAGCCACAGCCTGGGG - Intergenic
1145389486 17:22444542-22444564 GATGCTGGAGCCACAGCCTGGGG + Intergenic
1146008612 17:29177818-29177840 GATGCTCTGGCTCCTGCCTGTGG + Intronic
1148560405 17:48602673-48602695 GAGGCCGGGGCTCCAGGCGTCGG + Intronic
1151576643 17:74955773-74955795 GATGGTGAGGCACCAGCCTGAGG - Exonic
1152611111 17:81315418-81315440 GAGGCTGGAGCTCCAGCCCAGGG + Intronic
1152641482 17:81451180-81451202 AATGCTGTGGCTCAAGCCTGCGG - Intronic
1153993358 18:10419250-10419272 TCTCCTGGGTCTCCAGCCTTTGG + Intergenic
1154146706 18:11872933-11872955 CTTGCTGTGGCTGCAGCCTTGGG + Intronic
1154443513 18:14414077-14414099 GCTTCTGGAGGTCCAGCCTTAGG - Intergenic
1157842198 18:50968563-50968585 GATGATGGGGCATCAGCATTTGG - Intronic
1161308182 19:3578593-3578615 GAGGCTGGGGGTCCACCCTTTGG + Exonic
1161330358 19:3683932-3683954 GAAGCGGGGGCTCCAGCGTGGGG - Intronic
1161392365 19:4028211-4028233 GTGGCTGGGGGTCCAGCCCTGGG - Intronic
1161853871 19:6752999-6753021 GATCCTGGAGGTCCCGCCTTAGG + Intronic
1161993213 19:7697137-7697159 GAGGCTGGGGGGCCAGGCTTGGG - Intronic
1162028724 19:7908387-7908409 AATGCTGGGCCTCCTGCATTGGG + Intronic
1163476446 19:17528786-17528808 GCTGCTGGAGCTCCAGCCATTGG + Intronic
1163476538 19:17529430-17529452 GCTGCTGGAGCTCCAGCCATTGG + Intronic
1163667077 19:18608180-18608202 GAGGGTGGGGCTTCAGTCTTGGG - Intronic
1163859293 19:19732778-19732800 GACGCTGGGGCTCCCGGCTGCGG + Intronic
1165333425 19:35154040-35154062 GGTGCAGCGGCTCCAGCCTTGGG - Exonic
1166164511 19:40977909-40977931 GATCCTGGGGCTCCAGGGATGGG - Intergenic
1166185809 19:41138049-41138071 GATCCTGGGGCTCCAGGGATGGG + Intergenic
1166338899 19:42125653-42125675 GAGGCTGGGGCTGCAGTTTTAGG - Intronic
1166344305 19:42155888-42155910 GATGCTGGGGCTGGAGCCAAAGG + Intronic
1167438935 19:49497047-49497069 GATTCTGGGGCACCAGGCCTTGG + Intronic
1167781544 19:51601848-51601870 GAAGCTGGGACCCCAGACTTCGG + Intergenic
925125636 2:1453774-1453796 GAAGCCGGGGTTCCAGCCTCGGG - Exonic
925315634 2:2921126-2921148 GATGCTGAGGCTACAGCTTGGGG - Intergenic
926218821 2:10921780-10921802 GATCCTGGGGCTCCAGCTTCTGG - Intergenic
927083220 2:19650768-19650790 GATGCTGGGGCTCCTACTGTTGG - Intergenic
927497921 2:23563157-23563179 GAAGAGGTGGCTCCAGCCTTGGG + Intronic
927687234 2:25179491-25179513 GGGGCTGGGGCTGGAGCCTTTGG + Intergenic
927720040 2:25376676-25376698 GATGCTGGGGAGCCAGCTGTGGG + Intergenic
927860880 2:26559220-26559242 GAGGCTGGGGCTGCTGCCTGAGG + Intergenic
929543807 2:42842596-42842618 GTATCTGGGGCCCCAGCCTTGGG + Intergenic
930237301 2:48900409-48900431 GCTGCTGGGGCTGCCGCCTGGGG + Intergenic
931835983 2:66098644-66098666 CATGGTGGGTCTCCAGCCCTTGG - Intergenic
932430799 2:71672637-71672659 TGGGCTGGGGCTCCAGCCTGGGG - Intronic
933042578 2:77487661-77487683 GAAGGTGGGGCTTCGGCCTTTGG - Intronic
934529471 2:95076049-95076071 GGGGCTGAGGCTACAGCCTTAGG - Intergenic
934585397 2:95488520-95488542 GAAGCTGGGGCTGCAGCCTGTGG + Intergenic
934594068 2:95588236-95588258 GAAGCTGGGGCTGCAGCCTGTGG - Intergenic
934788715 2:97037446-97037468 GAAGCTGGGGCTGCAGCCTGTGG + Intergenic
935341805 2:102065534-102065556 GATGAAGGGGCTCCAGGCTAAGG - Intronic
936107853 2:109640785-109640807 GATGCTCAGTCTCCAGGCTTAGG - Intergenic
936141939 2:109948161-109948183 GGTGCTGGGGCTCCAGATTAGGG + Intergenic
936178627 2:110246109-110246131 GGTGCTGGGGCTCCAGATTAGGG + Intergenic
936202751 2:110423323-110423345 GGTGCTGGGGCTCCAGATTAGGG - Intronic
937222937 2:120352554-120352576 GCTGCTGGGGCTCCGCCCTGGGG + Intergenic
940667663 2:156628292-156628314 GATGCAGGGGATCCAGCAGTAGG + Intergenic
940985291 2:160046218-160046240 GCTGCTGCTGCTTCAGCCTTTGG + Intronic
941957474 2:171219465-171219487 GAGGCTGGGAGTCCAGCATTAGG + Intronic
942753204 2:179311314-179311336 AATGCTGGGGCTGCAGCCAAAGG + Intergenic
945978264 2:216287326-216287348 GCTACTGCGGCTCCAGCATTTGG + Intronic
946038808 2:216766231-216766253 GAGGCTGGGGGCCCAGCCCTGGG + Intergenic
946274239 2:218618742-218618764 GATGCGAGGGCTCCAGCTGTTGG + Exonic
946971341 2:225095308-225095330 GATTCTTGTGCTTCAGCCTTGGG + Intergenic
947491296 2:230596771-230596793 AATGCTGGTGCTCCAGTGTTGGG - Intergenic
948407359 2:237732333-237732355 GACTCTCCGGCTCCAGCCTTGGG + Intronic
948436692 2:237958537-237958559 GCGGCTGGGGCTGCAGCCTGGGG - Intergenic
948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG + Intronic
948738068 2:240023484-240023506 GACGCTGGGTCTACAGCATTAGG + Intronic
948795934 2:240402124-240402146 GCTGCTGGGGCTCCACCCTGAGG + Intergenic
948827496 2:240579686-240579708 TGGCCTGGGGCTCCAGCCTTGGG + Exonic
948902705 2:240964431-240964453 GGTGCGGGGGCCCCAGCCTGTGG + Intronic
1168860723 20:1044316-1044338 GGTGGAGGGGCTCCAGCCTCAGG + Intergenic
1169004678 20:2196714-2196736 GTTGCTGGAGTTCCTGCCTTGGG - Intergenic
1169418115 20:5434639-5434661 AATCCTGAGGCTCCAGCCCTGGG - Intergenic
1172477833 20:35252216-35252238 GATGCTGTGACTCCAACCTCAGG + Intronic
1172838620 20:37888610-37888632 GATGCTGGGCCTCGGGCCCTCGG - Intergenic
1173279408 20:41615244-41615266 GATACTGGGGCTACAGAGTTGGG - Intronic
1174188039 20:48720927-48720949 GCTGCTTGGGGTACAGCCTTGGG - Intronic
1175209267 20:57339475-57339497 GATGCTGATGCTCCTGGCTTAGG - Intronic
1175283406 20:57820532-57820554 GATGCTGGGGCTGCAAGCGTGGG + Intergenic
1175644336 20:60658383-60658405 GATGCTGGGAACCCAGGCTTAGG + Intergenic
1176213825 20:63939069-63939091 GATGCTGGGGACTCAGCCGTGGG - Intergenic
1176328284 21:5521097-5521119 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176399473 21:6299854-6299876 GTAGCTGGGGCTACAGGCTTGGG + Intergenic
1176437684 21:6689250-6689272 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176452577 21:6877161-6877183 GCTTCTGGAGGTCCAGCCTTAGG + Intergenic
1176461946 21:7016320-7016342 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176485507 21:7398098-7398120 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176830750 21:13742210-13742232 GCTTCTGGAGGTCCAGCCTTAGG + Intergenic
1179612944 21:42564262-42564284 GAGCCTGTGGTTCCAGCCTTGGG + Intronic
1180091058 21:45534027-45534049 GCTGCTGGGACCACAGCCTTTGG - Intronic
1181474483 22:23159845-23159867 GATGCTGGGCATCTTGCCTTGGG - Intronic
1181860458 22:25813868-25813890 GATGCAGGGTCTGCAGCCGTGGG - Intronic
1182003621 22:26941087-26941109 TCTGCTGCTGCTCCAGCCTTTGG + Intergenic
1183327734 22:37203551-37203573 ACTGCTGGGGCCCCAGCGTTGGG - Intergenic
1184176950 22:42794039-42794061 GGGGCTGGGGCTTCAGCCTTAGG + Intergenic
1184326648 22:43792727-43792749 GAGGCTTAGTCTCCAGCCTTGGG - Intronic
950425306 3:12922023-12922045 GATGGTGGGGATGCAGTCTTTGG + Intronic
950475064 3:13209891-13209913 GATGGTGGGGCTGGAGCCCTGGG - Intergenic
951111570 3:18810455-18810477 GATGCTGGGTGTACATCCTTAGG + Intergenic
952153422 3:30617667-30617689 AATGCTGGAGCTCAAGCTTTGGG - Intronic
954460188 3:50622059-50622081 GTTGCTGGGGCTGCTGCCTCTGG + Intronic
955787544 3:62556152-62556174 AAGGATGGGGCTCCTGCCTTAGG - Intronic
956737408 3:72248291-72248313 GATGCTGGAGGGCCAGGCTTGGG - Intergenic
961213266 3:125141659-125141681 GATGCTGGGGCTGCAGGCTGCGG + Intronic
961858133 3:129893285-129893307 GATGCTGGGGGTCGAGTCCTAGG + Intronic
962311685 3:134331412-134331434 GAGCCTGGGGCTCCAGCTTAGGG - Intergenic
962875588 3:139533859-139533881 GAAGCTGAGGCTCCAGCCACAGG + Intronic
963225067 3:142853992-142854014 GATGCCGGGGCTCCTGCCAGAGG + Intronic
963474824 3:145791640-145791662 GAAGCTGGGGTTCCTGTCTTGGG + Intergenic
967190888 3:186984101-186984123 GTTGCTTGGGCTCCAACCCTTGG + Intronic
967241750 3:187446373-187446395 GGTGCTGGGACTCCAGCTTGAGG - Intergenic
967515639 3:190365417-190365439 GATGGTGGGCTTCCAGCCTTAGG + Intronic
968704802 4:2072864-2072886 GGGGCTGGGGCTGCACCCTTTGG + Intronic
969278369 4:6152356-6152378 GGAGCTGGGGCTACAGGCTTAGG - Intronic
969458384 4:7314047-7314069 GATCTGGGGGCTCCAGCCTCTGG - Intronic
969874297 4:10124478-10124500 CATTCTGGGGCACCAGCCCTTGG + Intergenic
974088144 4:57282780-57282802 GATGCTGGGACTCCAGCTGCTGG + Intergenic
979809184 4:125014105-125014127 GATGCTGAGGCTCCCTCCTCAGG + Intergenic
980305457 4:131054909-131054931 GATGCTGGGGATCCTGCCATTGG - Intergenic
980485485 4:133451409-133451431 GATTGTGGGGCTTCAACCTTAGG - Intergenic
982052776 4:151518945-151518967 GGTGCGGTGGCTCGAGCCTTTGG - Intronic
982199514 4:152946663-152946685 GATGCTGTGGCTCCGGGCTCAGG - Intronic
985190441 4:187366799-187366821 GAAGCAGGGGCTCCAGCTTCAGG - Intergenic
985764859 5:1771950-1771972 GATGCTGGGGCTCCACTGATTGG + Intergenic
986285302 5:6354505-6354527 CAGGCTGGGGGTCCAGCCTCGGG + Intergenic
986285326 5:6354602-6354624 CAGGCTGGGGGTCCAGCCATGGG + Intergenic
986926600 5:12761305-12761327 AATGTTGAGGTTCCAGCCTTTGG - Intergenic
986934257 5:12863658-12863680 GCAGCTGGGGCTACAGGCTTGGG + Intergenic
990521874 5:56588779-56588801 GCTGCTGGGGCTGCAGCCACCGG + Intronic
990739962 5:58902478-58902500 GATGCTGGGGCTTTGGCCTCTGG + Intergenic
991998368 5:72411137-72411159 GCTGCTGGGGCACAAGCCCTCGG + Intergenic
992690771 5:79237741-79237763 GACACCGAGGCTCCAGCCTTTGG - Intronic
995900502 5:117060417-117060439 GATGCTGAGAATTCAGCCTTGGG + Intergenic
997829435 5:137137149-137137171 GATTATGAGGCTCCAGACTTAGG - Intronic
997845001 5:137278221-137278243 TATCCTGAGGCTCCAGCCTTTGG + Intronic
998335069 5:141364483-141364505 GCTCCTGGGGCTCCAGCCCAAGG - Exonic
998981357 5:147706289-147706311 GTTGCTGGTTCTCCAGTCTTGGG - Intronic
1001083307 5:168682518-168682540 GATGCTGGTGCTGCTGCCTTGGG + Intronic
1001832763 5:174803366-174803388 GATGCTGGTTCTCAAGGCTTTGG + Intergenic
1002259865 5:177985565-177985587 GTTGCTGGGGCGCCAGTCTGCGG + Intergenic
1002397979 5:178972673-178972695 GAGGCTGAGGCTGCGGCCTTTGG + Intergenic
1002433560 5:179218215-179218237 GCTGCTGGTGCTCCAGGCTTTGG - Intronic
1003033679 6:2624287-2624309 GTTGCTGGGAGCCCAGCCTTAGG + Intronic
1003447457 6:6197767-6197789 TATCCTGGGGCTCTAGACTTGGG + Intronic
1005098692 6:22146295-22146317 GATGCTGGGTCTGCAGCACTTGG + Intergenic
1005957278 6:30672920-30672942 GAAGCTGAGGCTCCAGCCGAGGG - Exonic
1011930130 6:92701146-92701168 GATCCTGGGGGTCCAGACCTCGG - Intergenic
1018901700 6:168054840-168054862 AAAGCTGAGGCTCAAGCCTTAGG + Intergenic
1019009793 6:168835008-168835030 GATGCACAGACTCCAGCCTTGGG + Intergenic
1021433547 7:20588765-20588787 GATTCTGGGGCTCCGCCCTGGGG - Intergenic
1022616834 7:31940481-31940503 TATTCTGGGGCTCCATTCTTTGG - Intronic
1023905228 7:44517070-44517092 GAGGCTCTGGCTGCAGCCTTGGG - Intronic
1024265905 7:47606285-47606307 AATGCTTCTGCTCCAGCCTTCGG - Intergenic
1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG + Intronic
1026684232 7:72494610-72494632 GGTGCTGGGGCTACAGGCATGGG - Intergenic
1026740292 7:72974961-72974983 GATGCTGGGACATCATCCTTGGG - Intergenic
1026797599 7:73376470-73376492 GATGCTGGGACATCATCCTTGGG - Intergenic
1027103439 7:75390109-75390131 GATGCTGGGACATCATCCTTGGG + Intergenic
1027654996 7:80919305-80919327 GGAGCTAGGGCTCCAGCCTGCGG - Exonic
1028260527 7:88658839-88658861 GATGCTGGGGTTACAGACATGGG - Intergenic
1028923422 7:96331233-96331255 GCTGATGGGGCTCCAGGCTGAGG - Intergenic
1029068049 7:97872188-97872210 GATGCTGCGGCTCCTGCGGTAGG - Intronic
1031762832 7:125735920-125735942 GATGCTGAGGCTGTAGCTTTTGG - Intergenic
1034199238 7:149272121-149272143 GATTCTGGAGCCCCAGCCTCTGG + Intronic
1034292357 7:149943029-149943051 GAAGCAGGGGCTCCAGCCGTGGG - Intergenic
1034354871 7:150444118-150444140 GAGCCTGTGGCTCCAGCCTTGGG - Intergenic
1034465205 7:151223913-151223935 GATGGTAGGGCTCCAGACCTGGG - Exonic
1034813716 7:154153883-154153905 GAAGCAGGGGCTCCAGCCGTGGG + Intronic
1036585985 8:10124070-10124092 GTGGGTGGGGCTGCAGCCTTGGG + Intronic
1037668604 8:20995676-20995698 AAGGCTGGGGCTCCAGTCCTGGG - Intergenic
1039471381 8:37815554-37815576 GATGCAGGGGCCCCAGCTCTGGG - Intronic
1042356793 8:67837056-67837078 GATGCAGGGGCTCCAGCAAGAGG - Intergenic
1042617357 8:70664496-70664518 GTTTCTGGGGCTCCAGTTTTAGG + Intronic
1044322510 8:90819999-90820021 ACTGCTGGGGGTGCAGCCTTTGG - Intronic
1047772758 8:128043537-128043559 GCTGCTGAGGCTCCTGCCGTAGG - Intergenic
1048177931 8:132169781-132169803 GATGCTGCGGCCCCGGCCCTGGG + Intronic
1048875993 8:138837483-138837505 GATGCTGAGACTGCAGCCTCTGG - Intronic
1049312145 8:141938890-141938912 GCTGCTGGGTCTCCAGCCAGGGG + Intergenic
1049441416 8:142611513-142611535 GGAGCTGTGGCCCCAGCCTTGGG + Exonic
1049603637 8:143519289-143519311 TGCCCTGGGGCTCCAGCCTTCGG + Intronic
1049749749 8:144277524-144277546 GAGGCTGGGACTCCAGCGTGCGG - Intronic
1049848782 8:144819726-144819748 GCTGCTGTGGGTCCAGCCTGGGG - Intergenic
1056560127 9:87722852-87722874 AGTGCTGGGGCTCTAGCCATGGG - Intergenic
1056568151 9:87792950-87792972 TGTGCTGGGGCTCTAGCCATGGG + Intergenic
1056801810 9:89697369-89697391 TCTCCTGGGGCTCCAGCCTGTGG + Intergenic
1058680786 9:107438583-107438605 GGTGCTGGGAATCCTGCCTTGGG - Intergenic
1059415088 9:114157215-114157237 CATGGTGGGGCTCCAGCTGTGGG + Intronic
1059427516 9:114230500-114230522 GAAGCTGGGTCTCCAACCTGTGG + Intronic
1060882261 9:127125522-127125544 GATGATGGGGCTGAAGCATTCGG + Intronic
1062473740 9:136717764-136717786 GATGCTGGGGCACCAGGCCCTGG + Intronic
1062541483 9:137043577-137043599 GATGCTGCTCCTCCAGCCTCTGG + Intronic
1203778529 EBV:87828-87850 GATACTGGGCCTCCTGCCGTGGG + Intergenic
1203433819 Un_GL000195v1:119375-119397 GTAGCTGGGGCTACAGGCTTGGG + Intergenic
1203516604 Un_GL000213v1:7354-7376 GCTTCTGGAGGTCCAGCCTTAGG - Intergenic
1186346251 X:8696184-8696206 GCTGCTGGGGCCCCTGCCATTGG + Intronic
1186496827 X:10017418-10017440 ACAGCTGGGGCTCTAGCCTTTGG - Intronic
1190276310 X:48901805-48901827 GATTCTGGGGATCCTGCCTGTGG + Intronic
1190952217 X:55157425-55157447 GATTCTGGTGCTTCAGCCTCCGG - Intronic
1193335601 X:80285142-80285164 GATGTAGGAGCTCCATCCTTGGG - Intergenic
1199849847 X:151717584-151717606 TATGCTGGGGGTTCAACCTTGGG + Intronic
1200058612 X:153474262-153474284 TATGCTGGGCCTCCTGCTTTAGG + Intronic
1200909139 Y:8515522-8515544 GACCCTGAGCCTCCAGCCTTGGG + Intergenic