ID: 1024613277

View in Genome Browser
Species Human (GRCh38)
Location 7:51085198-51085220
Sequence TCAGTGCGGTTGGGGATCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024613264_1024613277 19 Left 1024613264 7:51085156-51085178 CCTCACTCACCCATCGTGCTCTT 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 141
1024613263_1024613277 24 Left 1024613263 7:51085151-51085173 CCGAGCCTCACTCACCCATCGTG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 141
1024613267_1024613277 -4 Left 1024613267 7:51085179-51085201 CCTGTTCTCCTCCTTATCCTCAG 0: 1
1: 0
2: 3
3: 45
4: 492
Right 1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 141
1024613265_1024613277 10 Left 1024613265 7:51085165-51085187 CCCATCGTGCTCTTCCTGTTCTC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 141
1024613266_1024613277 9 Left 1024613266 7:51085166-51085188 CCATCGTGCTCTTCCTGTTCTCC 0: 1
1: 0
2: 1
3: 47
4: 471
Right 1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024613277 Original CRISPR TCAGTGCGGTTGGGGATCAG GGG Exonic
900828265 1:4944269-4944291 TCACCGAGGCTGGGGATCAGTGG + Intergenic
901667450 1:10834906-10834928 TCAGAGTGGGTGGGGCTCAGGGG - Intergenic
902771714 1:18648985-18649007 TCAGTACCCTTGGGCATCAGTGG - Intronic
904255418 1:29251545-29251567 TCAGTCTGGCTGGGGATCATAGG + Intronic
907325902 1:53638533-53638555 GCAGTGGGGTTGGGGGGCAGTGG - Intronic
907518995 1:55011067-55011089 CCACTGCGGTTGTGGTTCAGGGG - Intergenic
913324073 1:117611070-117611092 AGAGTGTGTTTGGGGATCAGGGG - Intronic
914517453 1:148386043-148386065 TCAGGGTGGTTGGGGATTGGTGG - Intergenic
915112343 1:153572085-153572107 TCAGTGCAGGTGGGGAGCACAGG - Intergenic
915946520 1:160156260-160156282 TGAGTGAGGTTGGTGATGAGGGG + Intronic
918169079 1:181978194-181978216 TCAGTGGGGTGGGGGACAAGGGG + Intergenic
918288322 1:183080610-183080632 TCAGACCTGCTGGGGATCAGAGG + Intronic
924946760 1:248851672-248851694 TCAGTGAGGTGAGGGAACAGAGG - Intronic
1070038400 10:72750788-72750810 TCAGGGGGGTTAGGGATGAGAGG - Intronic
1075591415 10:123694146-123694168 TCAGTGCTGTGGGGGTACAGAGG + Exonic
1075872042 10:125778100-125778122 TCAGTGCAGTTGGGGGTCAGAGG - Intergenic
1076412871 10:130264285-130264307 TCTGTGGGTTTGAGGATCAGGGG - Intergenic
1077292630 11:1805451-1805473 TCACTGGAGTTGGGGGTCAGAGG + Intergenic
1078536621 11:12180050-12180072 TCAGTGTGTTAGGGGATAAGGGG - Intronic
1080855777 11:36110441-36110463 TCAGAGCAGTCAGGGATCAGGGG + Intronic
1082141167 11:48611173-48611195 TGAGTGCGGTTGGGGCTCCTTGG + Intergenic
1082698916 11:56403172-56403194 TCAGAGCCGCTGGGGATCATGGG - Intergenic
1082800457 11:57410337-57410359 TCAGTGGGGTTGGAGAGAAGTGG - Intronic
1084864011 11:72041215-72041237 TCAGTGGGGGTGGGGCCCAGAGG + Intronic
1085587989 11:77729574-77729596 TTTGTGGGGTTGGGGTTCAGGGG - Intronic
1086864133 11:91959548-91959570 TCAGTGGGGTTGGGGATTAACGG + Intergenic
1086900864 11:92366359-92366381 TAACTGCAGATGGGGATCAGTGG - Intronic
1087227256 11:95615059-95615081 TCAGAGCAGTTGGGGATCCTGGG - Intergenic
1087689251 11:101300573-101300595 TCAGTGAGGTTGGGGTTTATAGG - Intergenic
1088103984 11:106185308-106185330 TCAGAGCGGCTGGGGATCACGGG + Intergenic
1089913183 11:122124444-122124466 TCAGGGCGGTGGGGGGGCAGGGG - Intergenic
1090231737 11:125111825-125111847 TCAGTTCGGTTGGGTAGCAGCGG + Intergenic
1090412246 11:126517427-126517449 TCAGTTTGGTTGGGCTTCAGAGG - Intronic
1090625476 11:128604437-128604459 TCAGTGGGATTGAGGATCTGGGG - Intergenic
1091343463 11:134837590-134837612 TCAGTGCTGGTGAGGGTCAGAGG + Intergenic
1091631210 12:2162287-2162309 TCAGAGCGGTTTAGGTTCAGCGG - Intronic
1093648711 12:21618743-21618765 ACAGTGTGGTTGGGGCTCAGAGG - Intergenic
1098997673 12:77139970-77139992 TCTGAGAGGTTTGGGATCAGGGG + Intergenic
1099219665 12:79898126-79898148 TAAGTGGGATTGTGGATCAGTGG - Intronic
1101878030 12:108608301-108608323 GCAGTGAGGATGGGGATGAGGGG - Intergenic
1107495915 13:40925538-40925560 TCAGGGAGGGTGGGGAGCAGGGG + Intergenic
1107559278 13:41545621-41545643 TCAGGAGGGCTGGGGATCAGTGG + Intergenic
1109004247 13:56850053-56850075 TCAGTGAGATTGGGAATCAGTGG + Intergenic
1114659394 14:24334964-24334986 GCAGTGAGTTCGGGGATCAGGGG - Exonic
1116956372 14:50927926-50927948 TTAGTGCATTTGGGGATCACTGG - Intronic
1117292251 14:54344993-54345015 TCAGTGGGGTGGGGGTTAAGGGG - Intergenic
1118163325 14:63312530-63312552 TAAATCCGGTTGGAGATCAGAGG + Intergenic
1118885207 14:69860252-69860274 TCTGGGTGGATGGGGATCAGGGG + Intronic
1202914930 14_GL000194v1_random:160041-160063 TCAGTGTGGTTGGGGAAAACAGG - Intergenic
1127242682 15:57135166-57135188 TCATTCTGGTTGGGGATCACAGG + Intronic
1128092234 15:64926807-64926829 CCAGAGTGGTTGGGGAACAGAGG + Intronic
1128490640 15:68138956-68138978 TCAGTGCTGTGTGGCATCAGTGG + Intronic
1129772821 15:78213551-78213573 GCAGTGGGGTTGGGCATGAGTGG + Intronic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1131254714 15:90854502-90854524 CCAGTGTGGTTGGGGACCCGGGG - Intergenic
1132678725 16:1131057-1131079 GCAGTGTGGGTGGGGGTCAGGGG + Intergenic
1134107444 16:11494338-11494360 TCAGTGGTGTTGGGGGGCAGTGG + Intronic
1134385481 16:13768148-13768170 ACAGTGTGGTTGGGGATGAGTGG - Intergenic
1135192435 16:20365715-20365737 TCAGGGCGATTTGGGGTCAGGGG + Intronic
1135309387 16:21393416-21393438 ACAGTGTGGTTTGGGACCAGCGG - Intergenic
1136148964 16:28333729-28333751 ACAGTGTGGTTTGGGACCAGCGG - Intergenic
1136306130 16:29372540-29372562 ACAGTGTGGTTTGGGACCAGCGG - Intergenic
1137579365 16:49623835-49623857 TCAGATAGGTTGGGGGTCAGGGG + Intronic
1141416316 16:83878113-83878135 GCAGTGTGGTTGAGGATTAGAGG + Intergenic
1142357315 16:89607885-89607907 TCAGAGCCGATGGGGATCGGGGG - Intergenic
1144127370 17:12215586-12215608 TCAGTGAGGTTGGGGAGGAAGGG - Intergenic
1144710275 17:17397073-17397095 TCACTGCTGTTTGGGGTCAGTGG - Intergenic
1144713634 17:17419648-17419670 TCAGTGCATTTGGGGATCAGAGG - Intergenic
1146821493 17:35986494-35986516 GGAGTGAGGTTGGGGCTCAGGGG - Intronic
1147944087 17:44070618-44070640 CCAGTGCGGTTCCGGGTCAGGGG - Intergenic
1151079500 17:71312312-71312334 TAAGTGCTGCTGGAGATCAGAGG - Intergenic
1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG + Intergenic
1157516205 18:48313464-48313486 TCAGGACTGTTGGGGAGCAGGGG - Intronic
1157910918 18:51616844-51616866 TCAATGGGGCTGGGGCTCAGTGG - Intergenic
1161820732 19:6529254-6529276 ACTGGGGGGTTGGGGATCAGGGG + Intergenic
1162967561 19:14163262-14163284 TCCGTGCGGTAGGGGATCCAGGG + Exonic
1163229126 19:15988071-15988093 TGGGTGCAGTTGGGGAACAGTGG - Intergenic
1163768778 19:19178350-19178372 TCAGTCAGGCTGGGGAGCAGGGG + Intronic
1165783179 19:38445653-38445675 AAAGTGAGGTTGGGGATCTGAGG - Intronic
932965697 2:76472397-76472419 TCAGAGCAGCTGGGGATCATGGG + Intergenic
936613754 2:114027529-114027551 TCATACAGGTTGGGGATCAGGGG - Intergenic
939643605 2:144669906-144669928 TCAGGGCGCCTGGGGAGCAGTGG - Intergenic
941970784 2:171348616-171348638 TTAGTGGGGTCAGGGATCAGGGG + Intronic
1171349761 20:24493686-24493708 TCAGTGGAGTTGGTGAGCAGTGG + Intronic
1174017750 20:47502254-47502276 GCAGTCCGCTTGGGGATCCGAGG + Intronic
1174569339 20:51490445-51490467 TGACTGAGGTTGGGGAACAGTGG - Intronic
1175340810 20:58228086-58228108 TCAGGGTGGTTGGGTTTCAGGGG + Intronic
1176634278 21:9174686-9174708 TCAGTGTGGTTGGGGAAAACAGG - Intergenic
1178040135 21:28631073-28631095 TCAATGGGGTTGGGGTGCAGAGG + Intergenic
1179575737 21:42307208-42307230 TCAGTGGGATGGGGGAGCAGAGG + Intergenic
1181325034 22:22038456-22038478 CCTGTGCCTTTGGGGATCAGGGG - Intergenic
1181332816 22:22107403-22107425 TCAGTGCCTTTGGGGTTGAGTGG + Intergenic
1181430519 22:22878857-22878879 TCAGTGGGGTGTGAGATCAGTGG - Intronic
1183144559 22:35977935-35977957 TAAGAGTGGTTGGGGGTCAGGGG + Intronic
1185036376 22:48479312-48479334 TCAGGGCGGGTCGGGATCGGTGG - Intergenic
1185036395 22:48479378-48479400 TCAGGGCAGGTCGGGATCAGTGG - Intergenic
950438366 3:12993800-12993822 GTTGTGGGGTTGGGGATCAGCGG - Intronic
952426557 3:33180798-33180820 TCAGTGAGGCTGGAGAGCAGTGG - Intronic
962915576 3:139900240-139900262 TCAGTAGGGTTGGGGATCCAGGG + Intergenic
963091079 3:141484678-141484700 TCAGTGTGGCTGGAGATCAGAGG + Intergenic
966303020 3:178499621-178499643 TCATTAGGGTAGGGGATCAGAGG + Intronic
968711933 4:2125780-2125802 TCAGTGCTTTTGGAGCTCAGTGG + Intronic
970110787 4:12635853-12635875 TCAGTGTGCTTGGGGCACAGTGG + Intergenic
980761987 4:137246650-137246672 TCAGAGCGGTGGTGGAACAGAGG - Intergenic
982996793 4:162359296-162359318 TCACTGCGGTTGGAGTGCAGTGG + Intergenic
984300895 4:177916504-177916526 TCAGTGGGGTGGGGGGTTAGGGG - Intronic
984502961 4:180579739-180579761 TCAGTGGGGTGGGGGGTGAGGGG + Intergenic
985128672 4:186720575-186720597 TCAGTGAGCTGGGGGATCTGGGG - Intronic
986046158 5:4040278-4040300 AAAGGGAGGTTGGGGATCAGAGG - Intergenic
987169310 5:15237789-15237811 TCAGTGAGGGTGAGGATGAGTGG - Intergenic
988919237 5:35925466-35925488 TCAGTATGGTTGGAGAACAGAGG + Intronic
991355274 5:65762577-65762599 TCAGTGGTGTTGGGGAAGAGGGG + Intronic
995986736 5:118185367-118185389 TCTTTGCTGTTGTGGATCAGGGG - Intergenic
999657919 5:153828731-153828753 TCAGTGGGGGTGGGGAGAAGTGG - Intergenic
1000859861 5:166444680-166444702 TCAGAGGGGGTGGGGATGAGAGG - Intergenic
1006739575 6:36297724-36297746 TGAGTGAGGTTGGAGCTCAGAGG + Intronic
1014008533 6:116449821-116449843 TCAGTGAGGTTGGAGAGGAGAGG + Intergenic
1017015005 6:150092822-150092844 TCAGAGGGGTAGGGGTTCAGTGG + Intergenic
1020698899 7:11452502-11452524 TCAGTGAGACTGGGGATCATTGG - Intronic
1024466053 7:49712157-49712179 ACAGTGCGGAAGGGGATCCGAGG - Intergenic
1024506899 7:50169407-50169429 GCAATGAGGTTGGGGAGCAGAGG - Intergenic
1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG + Exonic
1025215796 7:57054975-57054997 TCTGTGCAGTGGGGGATAAGAGG + Intergenic
1025655582 7:63515727-63515749 TCTGTGCAGTGGGGGATAAGAGG - Intergenic
1026390696 7:69898647-69898669 TGTGTGTGGTTGGGGATGAGGGG - Intronic
1027960653 7:84941312-84941334 TCAGAGCTGATGGGGATCATGGG + Intergenic
1034274184 7:149816885-149816907 CCAGTGAGGTTGGGGAACATGGG - Intergenic
1034685921 7:152971387-152971409 TCTGTGAGGTTGTGGTTCAGTGG + Intergenic
1037761524 8:21744949-21744971 TCAGAGCAGTTTGGGGTCAGTGG - Intronic
1041021503 8:53643072-53643094 TCAGGGGGGTTGGGACTCAGTGG - Intergenic
1041067157 8:54092952-54092974 TGAATGGGGTTGGGGATGAGTGG - Intronic
1042213621 8:66406445-66406467 TCAGTGCTGTGGAGGTTCAGTGG - Intergenic
1044818979 8:96143414-96143436 TCAGGGAGGATGGGGATCAAGGG - Exonic
1045137319 8:99234512-99234534 TCCGCGGGGTTGGGGTTCAGGGG + Intronic
1047204832 8:122794765-122794787 ACAGTGCATTTGGGGTTCAGGGG - Intronic
1047807099 8:128371966-128371988 TCAGTGCTGTTGTGGGTCTGAGG - Intergenic
1048387769 8:133928788-133928810 TCAGTGCGGTTGTGTATGTGTGG + Intergenic
1051509099 9:17857813-17857835 TCTCTGCGGTTGGGGGTGAGGGG + Intergenic
1055558600 9:77500595-77500617 TCAGTGGGGATGGGGATGGGAGG - Intronic
1056368648 9:85932215-85932237 TCAGTGGGGCTGGGGATGAGTGG - Intergenic
1059589409 9:115641885-115641907 ACAGTGAGGTTGGAGATCATTGG - Intergenic
1060399389 9:123339434-123339456 TCAGTGCGGTTGAGAAGCAGCGG + Intergenic
1061862143 9:133473519-133473541 GCAGTGCTGTTGGGGCTCAGAGG + Exonic
1188073300 X:25744573-25744595 TCAGAGCAGCTGGGGATCATGGG - Intergenic
1188572935 X:31611334-31611356 TCAGTGCTGTTGGAGATCTCAGG - Intronic
1188738036 X:33742291-33742313 TCAGGGCTGTTGGGGAGCCGTGG - Intergenic
1189303767 X:39971571-39971593 GCAGAGCTGTTAGGGATCAGGGG + Intergenic
1189379312 X:40490637-40490659 TCATTGGGGGTGGGGAGCAGAGG + Intergenic
1193541291 X:82775602-82775624 TCAGGGCTGTTGGTGGTCAGGGG - Intergenic
1195747842 X:108136541-108136563 TCAGGGCAGCTGGGGAACAGTGG + Intronic
1195824039 X:108977835-108977857 ATAGTGCGGTTGGGGAGAAGTGG + Intergenic
1197628141 X:128826569-128826591 ACAGTGCGGATGGAGAACAGGGG - Intergenic
1197892580 X:131281176-131281198 TCTGTTAGGTTGGGGAACAGGGG + Intronic
1200894117 Y:8356376-8356398 TAAGTGGGATTGGGGATCACTGG - Intergenic