ID: 1024613294

View in Genome Browser
Species Human (GRCh38)
Location 7:51085345-51085367
Sequence GTACCTATGAAGTACAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024613290_1024613294 29 Left 1024613290 7:51085293-51085315 CCCAAGAGATACCTATGAAGTAC 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1024613294 7:51085345-51085367 GTACCTATGAAGTACAAAGAAGG 0: 1
1: 1
2: 1
3: 15
4: 138
1024613293_1024613294 18 Left 1024613293 7:51085304-51085326 CCTATGAAGTACAAAGAAGGAAA 0: 1
1: 0
2: 9
3: 48
4: 466
Right 1024613294 7:51085345-51085367 GTACCTATGAAGTACAAAGAAGG 0: 1
1: 1
2: 1
3: 15
4: 138
1024613291_1024613294 28 Left 1024613291 7:51085294-51085316 CCAAGAGATACCTATGAAGTACA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1024613294 7:51085345-51085367 GTACCTATGAAGTACAAAGAAGG 0: 1
1: 1
2: 1
3: 15
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024613294 Original CRISPR GTACCTATGAAGTACAAAGA AGG Intronic
904194221 1:28772918-28772940 TTACATATTAAGTACAAAGGAGG - Intergenic
905736869 1:40335009-40335031 GTACATATTTAGTACAAAGAAGG - Intergenic
906169384 1:43710953-43710975 GTACCTACTATGTACAAAGTTGG - Intronic
909569709 1:77095451-77095473 GTGCTTATGCAGTAGAAAGATGG + Intronic
910881051 1:91922708-91922730 GAAACTATGAAGAAAAAAGAAGG - Intergenic
919959226 1:202450072-202450094 GAACCTGTGAAGCACAGAGAAGG + Intronic
921638813 1:217527433-217527455 GGCACCATGAAGTACAAAGAAGG - Intronic
921950069 1:220920368-220920390 GTACCTAGGAAGAGAAAAGAGGG + Intergenic
923170663 1:231413962-231413984 GTGATTATGAAGTACAAAGGTGG + Intronic
923533546 1:234830656-234830678 ATACCCATGAAGAACAAAGCAGG + Intergenic
924885691 1:248214117-248214139 GTACCCAAGAAGGACAAAGTTGG + Intergenic
1063000163 10:1910296-1910318 GTAACTAAGAAGTTCAATGATGG - Intergenic
1066030865 10:31422291-31422313 GAAGCTATGAAGTAGAAAGTAGG + Intronic
1067542805 10:47168177-47168199 TTACCTGTGAAGTAGAAACAAGG + Intergenic
1071800106 10:89050187-89050209 GTCTGTATGAATTACAAAGAAGG + Intergenic
1073494114 10:103876047-103876069 ATACCAAAAAAGTACAAAGAAGG - Intergenic
1075159851 10:120013581-120013603 GTACCTATTATGTACAAGAATGG - Intergenic
1076284336 10:129278243-129278265 ATAACGATGAAGTACACAGAGGG - Intergenic
1076371927 10:129960697-129960719 GTACCTTTGCAGTATAAACAGGG - Intronic
1077598107 11:3551980-3552002 GTACTTAGCAAGAACAAAGAGGG + Intergenic
1078038725 11:7836854-7836876 CTACCTATGAGGTAAAAAAATGG - Intergenic
1080416477 11:32074073-32074095 GTCCCTAGGAAGAACACAGATGG + Intronic
1087288747 11:96297033-96297055 GTACCTATGATGTGCACAGGTGG - Intronic
1089908630 11:122072521-122072543 CTACCTTTGGAATACAAAGAAGG + Intergenic
1090471812 11:126987674-126987696 GTCCCACTGAAGTAAAAAGAAGG + Intronic
1091229948 11:133981805-133981827 GTACAAATAAAGTACAACGAGGG + Intergenic
1092374712 12:7945873-7945895 ATACCTATGAGTGACAAAGATGG - Intergenic
1092657806 12:10705656-10705678 GTACTCATTAATTACAAAGAAGG - Intronic
1093000455 12:13990115-13990137 TTACCTATTATGTACAAAAAGGG - Intergenic
1105280899 13:18962068-18962090 GAGCATATGAAGTAGAAAGAAGG - Intergenic
1106960977 13:34997814-34997836 GTACTTATGAAGAACTAAGAAGG + Intronic
1108251594 13:48573208-48573230 GTGCCTATAAAGTCCAAGGAAGG + Intergenic
1109498170 13:63202609-63202631 GTACCTCAGGACTACAAAGATGG + Intergenic
1109762988 13:66855085-66855107 TTACTTATGAAGTACAAGAAAGG - Intronic
1110792115 13:79598109-79598131 GTACCTATAAAGAACAGAAAGGG + Intergenic
1110945197 13:81405311-81405333 GTGCCTATGAAGCAAAAATATGG - Intergenic
1111012464 13:82329555-82329577 GTACTTAGGAAGACCAAAGAGGG - Intergenic
1111330025 13:86753347-86753369 TTACGTATGAAGTAAGAAGAAGG + Intergenic
1111387446 13:87545204-87545226 GTAACTATGTATTACAAACAAGG + Intergenic
1112828702 13:103422408-103422430 GGACCAATGAACTACACAGATGG - Intergenic
1112833967 13:103490954-103490976 GGATTTATGAAGTACAAAGGAGG + Intergenic
1112882566 13:104125089-104125111 GAATCTATGAAGTAGAGAGAAGG - Intergenic
1116342682 14:43745108-43745130 CTAAAAATGAAGTACAAAGATGG - Intergenic
1116670425 14:47834303-47834325 ATATTTATGAAGTACAAATATGG - Intergenic
1121918858 14:97861697-97861719 GTACCAATGAAATACTTAGAGGG - Intergenic
1130814749 15:87419487-87419509 GTATTTATGAAGTCCCAAGATGG - Intergenic
1131207932 15:90467211-90467233 ATACCTATGAAGTCCAATTATGG - Intronic
1131729151 15:95260839-95260861 GTACCTATGAAGTACAAATGAGG - Intergenic
1135341854 16:21655081-21655103 GTACCTGGGAAGTACAAAAGAGG + Intronic
1139260985 16:65593692-65593714 GCACCTTTGAAGTACAATGTGGG + Intergenic
1145361114 17:22213272-22213294 TTATCTAAGAAGTACAACGAAGG + Intergenic
1147233812 17:39041395-39041417 GTACCTGTAGAGTACAAGGAGGG + Intergenic
1147841283 17:43373473-43373495 TTATCTAAGAAGTACAACGAAGG + Intergenic
1149058414 17:52391831-52391853 GTGACTATGAAGCACAGAGATGG + Intergenic
1155608460 18:27635280-27635302 GAACTTATTAACTACAAAGAAGG + Intergenic
1155732694 18:29180611-29180633 TTATCTAAGAAGTACAACGAAGG - Intergenic
1156102312 18:33611648-33611670 TTATCTAAGAAGTCCAAAGAGGG - Intronic
1156337178 18:36182418-36182440 GTACCTAGGAAGTCAGAAGAGGG - Intergenic
1156535009 18:37853959-37853981 GTACGTATAAAGTAGAAAAATGG - Intergenic
1157102505 18:44743443-44743465 GTACCTTTGAAATTCAAAAAGGG - Intronic
1158564400 18:58542628-58542650 GTACCAAGGAAGGACAAAGTTGG + Intronic
1159054781 18:63452868-63452890 TTATCTAAGAAGTACAACGAAGG + Intergenic
1159930157 18:74303610-74303632 GTACGTCTGAAGAACAAAGAAGG - Intergenic
1162838851 19:13340813-13340835 GTACCTATGAATTGGAAATAGGG + Intronic
1168374327 19:55863228-55863250 ATTCCTGTGAAGTTCAAAGATGG + Intronic
925492834 2:4413895-4413917 GTATCTATGAAGCACAATAATGG + Intergenic
925807229 2:7662418-7662440 GTTCCTATAGTGTACAAAGAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926652686 2:15363641-15363663 CTGCCTATAAAGGACAAAGAAGG + Intronic
926662958 2:15488609-15488631 GTACTTTTGAATGACAAAGAGGG + Intronic
927132724 2:20074089-20074111 TTATCTAAGAAGTACAACGAAGG + Intergenic
927723167 2:25400266-25400288 GTGCCTATCAAGTAAACAGAAGG - Intronic
927913638 2:26919234-26919256 GAACTTCTGAAGTATAAAGATGG + Intronic
930245702 2:48981200-48981222 CTATCTATGAAGTACAAGGAAGG - Intronic
932651344 2:73561226-73561248 TTATCTAAGAAGTACAATGAAGG - Intronic
933424360 2:82090960-82090982 GGAGCTATGTAGTACAAAAAAGG + Intergenic
935482283 2:103606099-103606121 GAAACTATGGAGGACAAAGACGG + Intergenic
938046558 2:128126548-128126570 GTATATATGAAACACAAAGAGGG + Intronic
938251680 2:129820670-129820692 GTATCTAAGAAGTACAACGAAGG - Intergenic
938486566 2:131716325-131716347 GTACTTATGAAGAACTAAGAAGG + Intergenic
939872883 2:147544497-147544519 TTACCTATGCAGTGTAAAGAGGG - Intergenic
942240356 2:173958557-173958579 ATACCTGTGAAGCACAACGATGG + Intronic
942902642 2:181140973-181140995 GTTGCTGTGAAGTACTAAGAAGG + Intergenic
943247021 2:185467718-185467740 ATATCTATGAAGTACAATAAAGG + Intergenic
946660243 2:221991969-221991991 GTATCTCTGAAGTGAAAAGATGG - Intergenic
1169582435 20:7038840-7038862 GTATCTATGACATACATAGAGGG + Intergenic
1176676960 21:9787691-9787713 GTAACTAGGAAATACTAAGAGGG - Intergenic
1178284516 21:31314403-31314425 CTACCTATGAAGAAGAAAAAGGG + Intronic
949201602 3:1387153-1387175 TTACCCATGAAGCACAAACAAGG + Intronic
949988944 3:9561392-9561414 GTACCTATGAAGTACAAGATGGG - Intergenic
952248528 3:31625496-31625518 AAATCTTTGAAGTACAAAGAGGG - Intronic
952470564 3:33646443-33646465 AAACCTATGCAGTACATAGACGG + Intronic
956116971 3:65928851-65928873 GTCCTTTTGAAGTACAGAGAAGG - Intronic
958507086 3:94993512-94993534 ATACCTATGAAGAATAAAGCAGG + Intergenic
963880901 3:150527208-150527230 GTAACTATGAAAAACACAGAGGG + Intergenic
964373380 3:156025174-156025196 GGAGCTATGAAATACAAAGAAGG - Intergenic
965267629 3:166565468-166565490 GTTTCTAGGAAGTACAAACAAGG + Intergenic
972819378 4:42682409-42682431 GCAACTATGAAGTAGAAAAATGG - Intergenic
977737062 4:100429422-100429444 TTACCTATGAAGTAGACAGGAGG - Intronic
978867229 4:113528425-113528447 TTACCTATGAAGTAGACAGGAGG + Intronic
979791676 4:124790656-124790678 TTACCTATGAAGTACAATGGTGG + Intergenic
980159781 4:129146451-129146473 TTACCTATGCAGTACATACAAGG - Intergenic
980505693 4:133717466-133717488 TTTCCTATGAAGAACAAAGAAGG + Intergenic
981340821 4:143619306-143619328 GTACTTATGAAATAGAAAGCAGG - Intronic
981866118 4:149421105-149421127 CTATCTATGCAGTACACAGATGG - Intergenic
982233852 4:153233733-153233755 CTTCCTATGAAGTAGAAGGAAGG + Intronic
983641566 4:169948185-169948207 GAAGTTTTGAAGTACAAAGAAGG + Intergenic
983764433 4:171460190-171460212 GTACCTATGAAGTGCAATAAAGG + Intergenic
985398582 4:189571093-189571115 GTAACTAGGAAATACTAAGAGGG + Intergenic
988084099 5:26451200-26451222 CTACCTCTGAACTACAAAAAGGG + Intergenic
988213481 5:28240737-28240759 GTTCTTATGAAGAACATAGAGGG + Intergenic
988342521 5:29992040-29992062 TTACATATGAACTACAAAAAAGG + Intergenic
988940742 5:36143403-36143425 ATATCTATAAAGTAAAAAGAAGG + Exonic
989443585 5:41502512-41502534 GTACAGATGAAGTAGGAAGAAGG + Intronic
990027884 5:51217998-51218020 TTACCTATGAAGAATAAAAAAGG + Intergenic
990171148 5:53051266-53051288 GTAACTATCAAGAACAAAGTTGG + Intronic
990600975 5:57358405-57358427 GTACCAATGAAGAAAAATGAAGG + Intergenic
993322273 5:86486762-86486784 TTACCTATTATGTAGAAAGAGGG - Intergenic
996522911 5:124447389-124447411 GTACCTCTGAGGTACAAATATGG + Intergenic
996856048 5:128008707-128008729 TTACCTATGAAGAAGAAAAAAGG + Intergenic
1000482669 5:161798775-161798797 ATTTCTATAAAGTACAAAGAAGG + Intergenic
1001604246 5:172948598-172948620 GTACCCATGGGGTACAGAGAGGG - Intronic
1005683738 6:28232020-28232042 CTCCCTATGAAGTATAAAAAAGG + Intronic
1008691052 6:53979319-53979341 GTACCTATGAAGTATGGAGAAGG + Intronic
1012662307 6:101916654-101916676 GTATCTCTGAAGTGCACAGAAGG - Intronic
1015258825 6:131211073-131211095 GTACCTAAGATGTACAAAGTGGG + Intronic
1015424299 6:133047934-133047956 GTACCTAAGGAGTATTAAGAGGG + Intergenic
1018330390 6:162721247-162721269 TTATCTAAGAAGTACAATGAAGG + Intronic
1021664932 7:22967733-22967755 ATATCTAGGAAGTATAAAGAAGG + Intronic
1024613292 7:51085301-51085323 ATACCTATGAAGTACAAAGAAGG + Exonic
1024613294 7:51085345-51085367 GTACCTATGAAGTACAAAGAAGG + Intronic
1028089690 7:86683371-86683393 GTACCTGTGCACCACAAAGATGG + Intronic
1030063026 7:105638349-105638371 TTACCTAGGAAGTACAGAGTTGG + Exonic
1032670491 7:134077843-134077865 TTATCTAAGAAGTACAATGAAGG - Intergenic
1035284951 7:157799957-157799979 GTACCTCTGAGGGACAAAGGAGG - Intronic
1037572928 8:20173706-20173728 ATTCCTATAAAGTACTAAGAGGG + Intronic
1040496984 8:47974443-47974465 GTAGCTCTGAAGAACAGAGACGG - Intronic
1042929969 8:74003569-74003591 TTACCTAAGAAGTACAGCGAAGG - Intronic
1046658651 8:116924660-116924682 TTATCTAAGAAGTACAATGAAGG - Intergenic
1050180125 9:2913367-2913389 GTACAAAAGAAGTGCAAAGAGGG + Intergenic
1050997392 9:12237618-12237640 GTTCCTATAGAGTACAGAGATGG + Intergenic
1056979221 9:91292818-91292840 GTATCTGTGAAGTACAATAAAGG - Intronic
1057190307 9:93083479-93083501 GTACTTATGAAATAAAAACAAGG - Intronic
1057882406 9:98802521-98802543 ATACCTACAAAGGACAAAGAGGG + Intergenic
1058040561 9:100297162-100297184 GTACTTGTGAACTACAAAGTAGG - Intronic
1186883087 X:13885770-13885792 GTGCCTATGAAGTACAGTCAAGG + Intronic
1188726237 X:33586576-33586598 GTACCTATGAACAAAATAGAAGG + Intergenic
1189254901 X:39630198-39630220 GTACCTAGGAAGGAGAATGAGGG - Intergenic
1189658696 X:43275445-43275467 TAACCTAGGAAGAACAAAGAAGG + Intergenic
1190558397 X:51661842-51661864 GTACCAAAGAAGAACAAAGTTGG + Intergenic
1196283635 X:113853880-113853902 GTAACTAGGATGTACAAAGATGG - Intergenic
1197505111 X:127292314-127292336 CTACCTATTAATTAAAAAGAGGG - Intergenic
1199186666 X:144923264-144923286 GTACCGAAGCAGTACAGAGATGG + Intergenic
1200274965 X:154723447-154723469 GAACCTAAGAAGTTCAGAGATGG + Intronic
1202237477 Y:22728657-22728679 TTATCTAAGAAGTACAATGAAGG + Intergenic
1202576130 Y:26328024-26328046 GAACCTGTGAAGCACAGAGAAGG - Intergenic