ID: 1024616066

View in Genome Browser
Species Human (GRCh38)
Location 7:51113097-51113119
Sequence GGTACTGGTCCCACACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024616062_1024616066 4 Left 1024616062 7:51113070-51113092 CCTCTGCACAGTAACATCTCTTG 0: 1
1: 0
2: 2
3: 14
4: 153
Right 1024616066 7:51113097-51113119 GGTACTGGTCCCACACATCCAGG 0: 1
1: 0
2: 0
3: 6
4: 87
1024616061_1024616066 5 Left 1024616061 7:51113069-51113091 CCCTCTGCACAGTAACATCTCTT 0: 1
1: 0
2: 1
3: 26
4: 222
Right 1024616066 7:51113097-51113119 GGTACTGGTCCCACACATCCAGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024616066 Original CRISPR GGTACTGGTCCCACACATCC AGG Intronic
901033519 1:6322322-6322344 GCTACTTCTCCCACACACCCTGG + Intronic
903551434 1:24159673-24159695 GGGACTGGTTTCACACAGCCAGG + Intronic
906745676 1:48220766-48220788 GGTACTGATCCCACCCATGAGGG + Intergenic
909853901 1:80504487-80504509 GGGTCTGGTCCCACAGCTCCTGG - Intergenic
910729908 1:90383889-90383911 GCTACTGGCCTCACAGATCCAGG - Intergenic
910806356 1:91192762-91192784 GGTCCTGGTCTCAAACAGCCAGG - Intergenic
913584724 1:120263014-120263036 TGTTCAGGTCCCACCCATCCTGG + Intergenic
913623459 1:120635345-120635367 TGTTCAGGTCCCACCCATCCTGG - Intergenic
914566721 1:148874870-148874892 TGTTCAGGTCCCACCCATCCTGG + Intronic
914606098 1:149255370-149255392 TGTTCAGGTCCCACCCATCCTGG - Intergenic
914805157 1:150986173-150986195 GGTACTTGTGCCTTACATCCTGG + Intronic
920022577 1:202967039-202967061 GGTCCCGATCCCGCACATCCGGG - Intronic
1074893221 10:117752391-117752413 GGTAACAGTCCCACACAACCGGG + Intergenic
1076107326 10:127834059-127834081 GGCACTGCTCCCAGACACCCTGG - Intergenic
1077695504 11:4389322-4389344 GATATTTGTCTCACACATCCAGG + Intronic
1078490234 11:11761611-11761633 GGAACAGATCCCACACATCTGGG - Intergenic
1083986285 11:66217731-66217753 GGTACTGGTGACACACCTCATGG - Intronic
1084392877 11:68890256-68890278 GCTCCTGGTCCCGCCCATCCCGG - Intergenic
1088746676 11:112809797-112809819 GGTTCAGGGCCCACCCATCCAGG - Intergenic
1090367018 11:126215100-126215122 GGAACTAGTCCCACATCTCCTGG - Intronic
1090395238 11:126414365-126414387 TGGGCTGGTCCCACACATCCAGG + Exonic
1091655225 12:2341180-2341202 GGCACTGGTCACACAGATCCTGG + Intronic
1094027106 12:25970362-25970384 GATAATGGTCCCACAAATCCCGG - Intronic
1094526070 12:31232092-31232114 GGAACTGGACCCAAAGATCCTGG + Intergenic
1098264561 12:68705704-68705726 GGCACTGGGCCCACACATGTAGG - Intronic
1098357263 12:69623546-69623568 GGTACTGATTCCTCACTTCCTGG + Intergenic
1104710541 12:130982700-130982722 TGTTCTCTTCCCACACATCCAGG - Intronic
1105468280 13:20667796-20667818 GCTTCTGGCCCCACACATTCTGG + Intronic
1113659693 13:112097190-112097212 TGCACGGGTCCCACAAATCCTGG + Intergenic
1115027478 14:28761333-28761355 AGAAATGGTCCCACACAGCCTGG - Intergenic
1129666172 15:77580676-77580698 GCTAGTTGTACCACACATCCTGG + Intergenic
1130937544 15:88482939-88482961 GGCTCTGGCCCCACACCTCCAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1145061736 17:19738271-19738293 GGCCCTGGTCCCGCACAGCCCGG + Intronic
1146840977 17:36153977-36153999 GATGATGGTCCCACTCATCCTGG + Intergenic
1147893835 17:43737320-43737342 GGTTCTGGTACCTCCCATCCCGG + Intergenic
1149858553 17:60106991-60107013 GATGATGGTCCCACTCATCCTGG - Intergenic
1152080655 17:78185393-78185415 GTTACTCCTCCCACACTTCCTGG - Intronic
1153353516 18:4108761-4108783 GGTACAGGTCAGACACATCTGGG + Intronic
1156610282 18:38717018-38717040 GGTTCTGGTCTCACATCTCCTGG + Intergenic
1163311770 19:16519260-16519282 TATACTGGTCCCACTTATCCCGG + Exonic
1166643093 19:44511377-44511399 GGTACTGGACCAGCACATGCTGG - Intronic
925950900 2:8910250-8910272 GGAACTGATCACACACATCTAGG + Intronic
930103423 2:47620155-47620177 GTTAATGGTCCAACACATCCTGG + Intergenic
930595117 2:53378071-53378093 GGTACAGGTCCCAAAAATTCAGG + Intergenic
938770819 2:134499348-134499370 GGCACAGGCCACACACATCCCGG + Intronic
939564045 2:143765779-143765801 GGTACTGGACCCAGACTGCCTGG + Intronic
941929279 2:170924459-170924481 GGTACTGGTGCAACCCAGCCAGG - Intergenic
943064535 2:183072231-183072253 GGAGGTGGACCCACACATCCAGG - Intergenic
943839562 2:192561581-192561603 TGAACTTGTCCCACACATCTTGG - Intergenic
945050765 2:205822046-205822068 AGAACTGCTCCCACACCTCCTGG + Intergenic
948863250 2:240763066-240763088 GGTACTGGTCCTCCAGTTCCTGG + Exonic
1170700738 20:18701127-18701149 GGTTCTGTTCCCACACATTCAGG + Intronic
1172028668 20:31967091-31967113 GGTGGAGTTCCCACACATCCTGG - Intergenic
1173250965 20:41364079-41364101 GGTAGAAGTCCCACCCATCCTGG + Intronic
1174609111 20:51784510-51784532 TGTACTGGTTCCACACAACAGGG + Exonic
1175244006 20:57570462-57570484 GGTGCTGGGCCTACACAGCCTGG + Intergenic
1177713149 21:24805963-24805985 GATACTGGTCCTACATATTCAGG + Intergenic
1179798514 21:43799505-43799527 TGTGCTGGCCCCAAACATCCAGG - Intronic
1182584084 22:31333597-31333619 GGTGCTGGTCCAACCCATGCTGG - Intronic
1183331779 22:37226203-37226225 CCTTCTGGTCCCACACCTCCAGG + Intronic
1184598307 22:45527517-45527539 GGCTCTGCTCGCACACATCCAGG - Intronic
1184607268 22:45581360-45581382 GGAAGTGGTCACACACATGCTGG - Intronic
953363563 3:42322442-42322464 GCTACTGGTTCCACACAACAGGG - Intergenic
963283774 3:143412989-143413011 GGAACTGGTCCTGAACATCCAGG + Intronic
965770969 3:172180791-172180813 AGAACTGGTTCCACAAATCCAGG - Intronic
971187658 4:24396074-24396096 GTTACTGATCCCACATCTCCTGG + Intergenic
981727434 4:147862225-147862247 GGTACTGTTGCCACCCAGCCGGG - Intronic
983982932 4:174021676-174021698 GGCACTGGTCCCAGAGATTCTGG - Intergenic
985745143 5:1642620-1642642 GCTGCTGCTCCCACACCTCCAGG + Intergenic
993364551 5:87019964-87019986 GAGACTGGTCCCACCCATCGTGG - Intergenic
1004566974 6:16807240-16807262 GGACCTGGTCCCACCCATCAGGG - Intergenic
1007407729 6:41644491-41644513 GGGTCTGGTCCCCCACAGCCAGG - Intronic
1008506659 6:52237288-52237310 GGTTCTGGAGCCACACAGCCTGG + Intronic
1013173899 6:107661493-107661515 GGTACTGGTGCCAAGCCTCCTGG - Intergenic
1014522173 6:122457952-122457974 GGTTCTGGTCCTACAAAACCGGG - Intronic
1014921763 6:127221792-127221814 GGTACCGTACCCACAAATCCAGG - Intergenic
1019527979 7:1489381-1489403 GGTACTCCTCCCACGCAGCCAGG + Exonic
1020715202 7:11665741-11665763 GCTTTTGGTCCCACACAACCTGG - Intronic
1022537448 7:31106861-31106883 GGTACTGGTCCCACCCACTGTGG + Exonic
1024616066 7:51113097-51113119 GGTACTGGTCCCACACATCCAGG + Intronic
1031274717 7:119705624-119705646 TGTAATTGTCCCACACATCTTGG + Intergenic
1035366132 7:158350093-158350115 GGTACAGATCCCATACATCTTGG - Intronic
1038777533 8:30544528-30544550 GGTACGGGGCCCACACTTCAGGG - Exonic
1042563413 8:70090605-70090627 GGTGATGGTCCCAGACATCTGGG + Intergenic
1049746369 8:144264945-144264967 GGAACTGGTCCAGCTCATCCCGG + Exonic
1055353822 9:75417318-75417340 GATACTGGGCCCTCACATACTGG + Intergenic
1059838769 9:118188786-118188808 GGAACTGTTCCCACAGAGCCTGG + Intergenic
1060519411 9:124285765-124285787 GGTTCTGGAGCCACACAACCGGG + Intronic
1191977629 X:66891074-66891096 GGTTCTGGAGCCAGACATCCTGG - Intergenic
1195338535 X:103880416-103880438 GGTCCTGGTCCTACACACCAAGG - Intergenic
1197001538 X:121445566-121445588 GGTACTAGAGCCACACTTCCAGG - Intergenic
1199807093 X:151311049-151311071 TTTACTGGTCCCACAGTTCCTGG + Intergenic
1201688166 Y:16730985-16731007 GGGACTGTTCCCAAACATCCTGG + Intergenic