ID: 1024616932

View in Genome Browser
Species Human (GRCh38)
Location 7:51123692-51123714
Sequence CAGGGAAGTCATGCATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024616932 Original CRISPR CAGGGAAGTCATGCATTTGC TGG (reversed) Intronic
900350759 1:2233446-2233468 CTGGGAATTCAGGCATCTGCAGG - Intronic
900631128 1:3636162-3636184 CAGGGATTTCATGCATTTCCAGG - Intronic
901084496 1:6602382-6602404 CAGCGAAGTCCTGCATGTCCAGG + Exonic
902457262 1:16543675-16543697 CATGGAAGTCCTTCAATTGCTGG - Intergenic
902483958 1:16729591-16729613 CATGGAAGTCCTTCAATTGCTGG + Intergenic
902494904 1:16864235-16864257 CATGGAAGTCCTTCAATTGCTGG + Intronic
905075418 1:35266761-35266783 CAGGGCAGTCATCCATATGGAGG - Intergenic
905672719 1:39802773-39802795 CAGGAAAGACATGAATTTGTGGG - Intergenic
907158419 1:52354735-52354757 CAGGGAAGGCAGGAATGTGCTGG + Intronic
907161691 1:52375503-52375525 CAGGGGAGTCAGGCTTCTGCTGG + Exonic
909003977 1:70254122-70254144 CAGGGATGAAATGCATTAGCTGG - Intergenic
910329834 1:86059155-86059177 CAGGGAATTCCAGGATTTGCTGG - Exonic
910759615 1:90720916-90720938 CCAAGAAGTCATGCATTTTCTGG + Intergenic
911117330 1:94259406-94259428 CTGGGAAGACATGCATTTTATGG - Intronic
911390629 1:97236825-97236847 GAGGGAGGTCATGCATGTGTTGG + Intronic
913347665 1:117824731-117824753 CAGGGAAGCCAGGGATTTGGTGG + Intergenic
920750177 1:208666904-208666926 TGGAGAAGTCATCCATTTGCAGG + Intergenic
921518147 1:216123354-216123376 CAGGCAATCAATGCATTTGCTGG + Intronic
921691081 1:218151427-218151449 CAGGATAGACATGCATTTGGGGG - Intergenic
922649086 1:227321241-227321263 AAGCCAAGTCATTCATTTGCAGG - Intergenic
923471918 1:234298929-234298951 GAGGGCAGCCATACATTTGCTGG + Intronic
1065119590 10:22515605-22515627 GAGGGAAGTGATGGATTTGAGGG + Intergenic
1066043455 10:31576554-31576576 CAGAGAAGTCAAGCTTTTGTGGG + Intergenic
1067030386 10:42875622-42875644 CACGGTAGGCATGCATTTGTTGG + Intergenic
1068823533 10:61407215-61407237 CTGGAAAGGCATGCATTTGTAGG - Exonic
1069853148 10:71423559-71423581 CAGGGGGGTGATGCATTTGCTGG + Intronic
1071455764 10:85850311-85850333 CAGGCAAGTCATGCTTGTGGAGG + Intronic
1072348582 10:94534546-94534568 CAGGGAAATCATGCATTTCTTGG - Exonic
1073140732 10:101245804-101245826 CAGGGAAGTGATGAGCTTGCTGG + Intergenic
1074290281 10:112133158-112133180 CTGGGAAGACATGAATTTGTGGG + Intergenic
1074323096 10:112421663-112421685 CAGGTAAGTCCTCCATCTGCTGG + Exonic
1074689926 10:115995108-115995130 AAGGGAAGGCAGGCATCTGCAGG - Intergenic
1076337181 10:129714873-129714895 CAGGGACATCATGAATTTCCTGG - Intronic
1076993508 11:287862-287884 CAGGGAACCCAGGCAGTTGCAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080413059 11:32044505-32044527 AAGGGAACTCAAGCATTTGGGGG + Intronic
1080894620 11:36439087-36439109 CAGGAAAGACCTGCATTTGTAGG + Intronic
1081723503 11:45307305-45307327 CTGGGAAGTCTGGAATTTGCCGG + Intergenic
1081771628 11:45653776-45653798 CAAGGAAGGCAAGCACTTGCTGG + Intronic
1085031227 11:73272042-73272064 CAGGGAAGGCACGCATTGGGTGG - Intronic
1088715883 11:112549226-112549248 CAAGGAAGTCCAGCATTTGGAGG - Intergenic
1097065719 12:56319113-56319135 CAGGGAAATCATTCGTTTTCGGG + Exonic
1098845650 12:75532370-75532392 GAGGGAAGGATTGCATTTGCAGG - Intergenic
1099502668 12:83432719-83432741 CAGGGAAGCCCTGCAGCTGCAGG + Intergenic
1100663991 12:96730303-96730325 CATAGAAGTCTTGCATTTCCTGG - Intronic
1108279535 13:48847803-48847825 CAGGGAAGACCTGCAGTTCCAGG + Intergenic
1109509463 13:63351146-63351168 CCTGGAAGCCATGGATTTGCTGG + Intergenic
1110154790 13:72303207-72303229 CATGGTAGTAATGCAATTGCTGG - Intergenic
1110228583 13:73144872-73144894 CAGGAAAGTCATTCCTTTTCTGG - Intergenic
1110789060 13:79567417-79567439 CAGGGGAGTCATTTATTTGATGG + Intergenic
1112261139 13:97879603-97879625 AGGGGAAGGCATGTATTTGCAGG + Intergenic
1114827049 14:26093721-26093743 CAAAGTAGTCATGCATGTGCTGG + Intergenic
1118205122 14:63715749-63715771 GAGGGAACTCATGAAGTTGCTGG + Intronic
1119175080 14:72562897-72562919 CAGGGAGGTGATGCAAATGCTGG - Intronic
1121690575 14:95875338-95875360 CAGGGAAGTAAGGCAAGTGCCGG - Intergenic
1123694648 15:22869683-22869705 AAGGGATTTAATGCATTTGCTGG + Exonic
1125549600 15:40535682-40535704 CAGGGAAGTCATCAGTGTGCGGG + Intronic
1126599643 15:50416012-50416034 CAGGGAAGTCATTTATTTGGTGG + Intergenic
1126800509 15:52293492-52293514 CAGGCAAGTTCTGTATTTGCAGG - Intronic
1126874627 15:53027422-53027444 CAGTGAAGTGATGCATTTATAGG + Intergenic
1127701587 15:61506565-61506587 CAGGGAACTTATGCAGTTTCAGG - Intergenic
1128726199 15:69990254-69990276 CAGGGAAGTCCTCCCTGTGCAGG - Intergenic
1129775918 15:78236427-78236449 CTGGGTAGACATGAATTTGCTGG + Intronic
1133530525 16:6651236-6651258 CAGGGAGGGCATGGATGTGCAGG - Intronic
1134186977 16:12092085-12092107 CAGGGAAGTGCTGCACTTGGGGG - Intronic
1134210449 16:12272046-12272068 CAAGGAAGTCAGGTAGTTGCAGG + Intronic
1138561465 16:57803123-57803145 CTGGGAAGATATTCATTTGCTGG - Intronic
1139601333 16:67989307-67989329 CAGGGAAGGCACTCACTTGCCGG + Exonic
1140719907 16:77762241-77762263 CACTGAAGTTTTGCATTTGCTGG + Intergenic
1141817892 16:86425356-86425378 GAGGGAAAGCCTGCATTTGCTGG + Intergenic
1142117828 16:88369271-88369293 AAGGGCAGTGATGCATGTGCTGG - Intergenic
1142211227 16:88809584-88809606 CAGGGAACACATTCCTTTGCTGG - Exonic
1142703247 17:1677365-1677387 AGAGGCAGTCATGCATTTGCAGG - Intronic
1145183086 17:20770255-20770277 CAGGGTCTTCCTGCATTTGCAGG + Intergenic
1146396233 17:32469654-32469676 CTGGGAAGCCATGGATTGGCAGG + Intronic
1147237127 17:39066155-39066177 CAGGCAAGTCCTGCCTTTGGAGG + Exonic
1150720308 17:67608984-67609006 CAGGGAAGCCATGCATGTTGGGG - Intronic
1152018500 17:77767956-77767978 CAGGGAAAGCATGCCTTTCCGGG - Intergenic
1152109493 17:78349831-78349853 CAGGGAAGTGATGAATATGGTGG + Intergenic
1152900675 17:82939338-82939360 CAGGGATGCAGTGCATTTGCCGG - Intronic
1153650475 18:7235383-7235405 CAGTAAAGTCATGCTTGTGCTGG + Intergenic
1153772315 18:8425930-8425952 CAGGGAAGCCCTGCAGGTGCTGG - Intergenic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1156309501 18:35909144-35909166 CAGGGAAGTCAGGCCTTTGCTGG - Intergenic
1157344921 18:46819744-46819766 AAGGGAAGTCATGAATGTACTGG + Intronic
1160124972 18:76163423-76163445 CAGGGAAGTCAAGCAGTGACAGG + Intergenic
1160342320 18:78100333-78100355 CTGGGAAGAGATGCTTTTGCAGG - Intergenic
1167180302 19:47898077-47898099 CAGAGGACTCCTGCATTTGCAGG + Intergenic
1168407550 19:56118843-56118865 CAGGGCAGCCAGGCAGTTGCTGG + Intronic
1202708221 1_KI270713v1_random:40236-40258 CATGGAAGTCCTTCAATTGCTGG - Intergenic
928912705 2:36439083-36439105 CAGGGGAAACATTCATTTGCAGG - Intronic
929745157 2:44649540-44649562 AAGGGAAGACAGGCATCTGCTGG + Intronic
930327604 2:49939900-49939922 CAGGGAAGTTATATATTTGGTGG - Intronic
931283487 2:60813796-60813818 CAGGGAAGGCAAACATTTGAAGG + Intergenic
932709242 2:74049675-74049697 CAAGTAAGTCATGTACTTGCTGG + Intronic
934778078 2:96951405-96951427 CCGGGCAGTCAGGCATGTGCAGG + Exonic
934970505 2:98760074-98760096 CAGAGAAGTCATGGTTTTGAGGG + Intergenic
935280702 2:101515405-101515427 CAAGCAAGTCTTGCCTTTGCAGG - Intergenic
937645114 2:124257967-124257989 CATGCAATTGATGCATTTGCTGG + Intronic
937935001 2:127236549-127236571 CATGGAAATAATGCATTTGATGG + Intergenic
942895572 2:181049132-181049154 CAGAGAAGTCAAGGATCTGCTGG + Intronic
944543792 2:200779315-200779337 CAGGAAAATCATGGGTTTGCAGG + Intergenic
946066345 2:216990753-216990775 CAGGGAAGTCAGGCAGTTTAGGG - Intergenic
946461146 2:219869997-219870019 CAGGGATGTCAGGCTTCTGCTGG + Intergenic
948320835 2:237067730-237067752 CAGGAAAGGCATGCATATGGTGG + Intergenic
948659212 2:239496854-239496876 CAGGGATGTCATTGATTGGCTGG - Intergenic
948659247 2:239497094-239497116 CAGGGCTGTCATTCATTGGCTGG - Intergenic
1170990605 20:21298613-21298635 CAGGGAAGAGGTGCATCTGCTGG + Intergenic
1171332972 20:24357567-24357589 CAAGGAAGACATTTATTTGCAGG + Intergenic
1172816854 20:37694090-37694112 CAGGGAAGTGGAGTATTTGCTGG + Exonic
1175735811 20:61386281-61386303 CAGGGAGGCCATGCCTTTGGAGG - Intronic
1176205162 20:63884218-63884240 TAGGGAAGACCTGCATTTGTAGG - Intronic
1182695469 22:32196189-32196211 CAGAGAAGTGATGAATCTGCAGG + Intronic
1184528780 22:45041297-45041319 AAGGGAAGTCCTGGCTTTGCTGG - Intergenic
1184908989 22:47513388-47513410 CAGGGACTTCATGCATTGGTGGG - Intergenic
949292215 3:2480442-2480464 CAGGAAAGTCAGTCATTTACTGG - Intronic
952087260 3:29839303-29839325 CAGGGAAGTCATGAAACTGAGGG - Intronic
953521578 3:43648235-43648257 CAGGGAAGACAAACATTTGGAGG + Intronic
956537595 3:70295152-70295174 CAGGGCAGTCATGCATTTCCAGG - Intergenic
958149882 3:89677840-89677862 CATGGCAGTCTTGCATTTTCTGG + Intergenic
958640599 3:96800294-96800316 CAGGGAATTCTTTCCTTTGCTGG + Intergenic
958821647 3:98980905-98980927 CAGGTAAGTCAAGCATTTTGAGG - Intergenic
960248998 3:115431777-115431799 CAGGGAAGTAATACATTTCTGGG + Intergenic
963563105 3:146892197-146892219 CCGAGAAGTCAAGCAGTTGCTGG - Intergenic
966157672 3:176934741-176934763 AAGGGTGGTCATGAATTTGCAGG - Intergenic
967308078 3:188078252-188078274 CAAGGAAGTAATGCATGTGTTGG + Intergenic
968939655 4:3631255-3631277 CAGGGAGGTGAAGCCTTTGCTGG - Intergenic
969387862 4:6868010-6868032 CATGGAAGTCTTGCTTTTCCTGG + Intronic
970553756 4:17210981-17211003 CAGGGAAGTCTTAAATTTGTAGG - Intergenic
970737737 4:19194367-19194389 CCTGGAAGTCATGCATATTCAGG - Intergenic
974059881 4:57022513-57022535 CAGAGAGGTCATGCAATTTCTGG + Intronic
977542568 4:98335307-98335329 CAGGTTGGTCATGCAGTTGCTGG + Intronic
979939910 4:126749537-126749559 TGGGGAAGTTATGCATTTGTGGG - Intergenic
981595123 4:146411819-146411841 GATGTAAGTCATGCATTTGCTGG + Intronic
982637165 4:157911318-157911340 AAGGGAAGTCATACAATTCCAGG + Intergenic
983668068 4:170204779-170204801 CAGGAAAGTTTTCCATTTGCTGG - Intergenic
985480645 5:108132-108154 CAGGGGAGTAAGACATTTGCTGG + Intergenic
985555541 5:556189-556211 CAGGGAAGCCATGGATCTGGTGG - Intergenic
987051288 5:14148668-14148690 CAGTGAAGACTTGGATTTGCGGG + Intronic
990561869 5:56991594-56991616 GAGGGCAGACATGCCTTTGCAGG - Intergenic
996850236 5:127943380-127943402 CAGGGAAATCATGGATTTGGGGG - Intergenic
997387186 5:133482819-133482841 CAGGGAAGCTCTGCATTTCCTGG + Intronic
997817776 5:137035034-137035056 CAGGGAAGGCATGCATCTGATGG - Intronic
998520385 5:142794796-142794818 CAGGGCAGTCAATCATTGGCCGG - Intronic
1001307528 5:170586236-170586258 GAGGCCAGTCATGCATTTGGAGG - Intronic
1002980579 6:2132415-2132437 CTGGGAAGCCAGGCATTTCCTGG + Intronic
1003478179 6:6504679-6504701 AGGGGAAGTCTTGCCTTTGCTGG - Intergenic
1003558015 6:7158009-7158031 CAGAGAAGTCAGGCATGAGCCGG - Intronic
1008436996 6:51487573-51487595 GAGGTAAGTCAAGCATTAGCAGG + Intergenic
1012796936 6:103774278-103774300 CAGGGGAGTCAGGCACTTCCAGG - Intergenic
1015020549 6:128468628-128468650 CACCGAAGTCATGGAATTGCTGG - Intronic
1015041446 6:128725170-128725192 CAGGGAAATCTTACATTTGAAGG - Intergenic
1016570109 6:145502438-145502460 CAGGAAAGTCATATATTTGGGGG - Intronic
1020505559 7:8982802-8982824 AAGGGGAGGAATGCATTTGCAGG + Intergenic
1020605895 7:10336402-10336424 CAGGTAAATTATACATTTGCAGG + Intergenic
1021115645 7:16743855-16743877 CAGGGGAGTCACGCATTTTGGGG - Intergenic
1021673467 7:23056947-23056969 GAGGCATGTCATACATTTGCTGG + Intergenic
1022217747 7:28281073-28281095 CAGGGATGTCATGTAAATGCAGG + Intergenic
1023866090 7:44239106-44239128 CAGGGCAGACATGCATGTGTAGG + Intronic
1024616932 7:51123692-51123714 CAGGGAAGTCATGCATTTGCTGG - Intronic
1024790666 7:52961892-52961914 CAGGCAAGTGCTGCATTTGAAGG - Intergenic
1026455828 7:70571799-70571821 CAGGGCAGTCACGTCTTTGCAGG + Intronic
1026666037 7:72340546-72340568 AAGGGAAGGCATGTATTTGCAGG - Intronic
1028097265 7:86776804-86776826 CCTGGAAGTCATGCTTTCGCAGG + Intronic
1029082469 7:97985595-97985617 CAGTGAATTCATGCATTATCAGG - Intronic
1029336995 7:99909597-99909619 GAAGAAAGTCATGCATTTACAGG - Exonic
1032024676 7:128431504-128431526 CAGGGAAGTAATGCAAATGCTGG - Intergenic
1032534339 7:132649276-132649298 CACTGTAGTCATGCACTTGCTGG + Intronic
1032855829 7:135832738-135832760 CAGGGAAGTCAGACATCAGCAGG + Intergenic
1033216261 7:139495732-139495754 CAGGGAAGTCAGGCCACTGCAGG + Intergenic
1035457251 7:159016611-159016633 AAGGGAGGGCATGTATTTGCAGG - Intergenic
1035927644 8:3745668-3745690 CGGGGAAGTCAGGCAGCTGCTGG + Intronic
1040396136 8:47002129-47002151 CATGGGAGTCATTCATTAGCAGG + Intergenic
1042097754 8:65236478-65236500 CAGGGAAATGATGCATATGAAGG + Intergenic
1042225161 8:66509502-66509524 CAGAGAAGTCATGCCTGTGCTGG - Intronic
1042892878 8:73632886-73632908 CAGGGTTCTCAAGCATTTGCAGG - Intronic
1044169176 8:89027447-89027469 CAGGGAAGCCATCCCTTTGTAGG + Intergenic
1048326299 8:133441955-133441977 CAGGGTAGTCCTGGTTTTGCAGG + Intergenic
1049480215 8:142819065-142819087 CAGGGAGGTCATGCCCTGGCAGG - Intergenic
1055496691 9:76861903-76861925 CAGGGAAGTTAAAGATTTGCGGG - Intronic
1055857332 9:80705847-80705869 CAGGGAAGAAGTGCATTTGTGGG - Intergenic
1056757619 9:89391753-89391775 TACGTAAGGCATGCATTTGCTGG + Intronic
1060439976 9:123629151-123629173 CAGGTCAGTCATACTTTTGCTGG - Intronic
1062424611 9:136500335-136500357 CAGGGAAGTCAGGCAGAGGCGGG - Intronic
1062584101 9:137241363-137241385 GAGGGAAATCGTGCACTTGCAGG + Exonic
1062721751 9:138048027-138048049 CACGGAAGTCATGGACGTGCAGG - Intronic
1187416085 X:19094619-19094641 CAGGAAAGTCTTGCAGTGGCTGG + Intronic
1187779731 X:22805963-22805985 CGGGAAAGATATGCATTTGCAGG + Intergenic
1188841522 X:35023664-35023686 CAGGGCAGTGATACATTGGCAGG + Intergenic
1188979240 X:36712290-36712312 TAGGGAGGTGATGCATTTGTGGG + Intergenic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1195810769 X:108826167-108826189 CAGGGAAGTGATGCCTTTATAGG + Intergenic
1200151939 X:153955464-153955486 CAGGGAGGTCATGCACAGGCTGG + Exonic