ID: 1024617327

View in Genome Browser
Species Human (GRCh38)
Location 7:51126828-51126850
Sequence CCAAGTCGCTGGTTAATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024617320_1024617327 26 Left 1024617320 7:51126779-51126801 CCTATTTGCTCTCCATTCACCAA No data
Right 1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1024617319_1024617327 27 Left 1024617319 7:51126778-51126800 CCCTATTTGCTCTCCATTCACCA No data
Right 1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1024617323_1024617327 2 Left 1024617323 7:51126803-51126825 CCCTGCAGCTGTAGCAGAACATC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1024617322_1024617327 7 Left 1024617322 7:51126798-51126820 CCAAACCCTGCAGCTGTAGCAGA 0: 1
1: 0
2: 0
3: 18
4: 246
Right 1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1024617324_1024617327 1 Left 1024617324 7:51126804-51126826 CCTGCAGCTGTAGCAGAACATCA 0: 1
1: 0
2: 2
3: 18
4: 202
Right 1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1024617321_1024617327 14 Left 1024617321 7:51126791-51126813 CCATTCACCAAACCCTGCAGCTG No data
Right 1024617327 7:51126828-51126850 CCAAGTCGCTGGTTAATTCAAGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024617327 Original CRISPR CCAAGTCGCTGGTTAATTCA AGG Intronic