ID: 1024617639

View in Genome Browser
Species Human (GRCh38)
Location 7:51128916-51128938
Sequence ATTTCCCTCAGTGCGAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024617639_1024617642 -2 Left 1024617639 7:51128916-51128938 CCCGACCTCGCACTGAGGGAAAT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1024617642 7:51128937-51128959 ATAAGATCGTTCTCTAGCTCTGG No data
1024617639_1024617643 16 Left 1024617639 7:51128916-51128938 CCCGACCTCGCACTGAGGGAAAT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1024617643 7:51128955-51128977 TCTGGCACTCGCACTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024617639 Original CRISPR ATTTCCCTCAGTGCGAGGTC GGG (reversed) Intronic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
903959889 1:27050272-27050294 ATTTGCCTCAGTGGGACTTCAGG - Intergenic
904929476 1:34074942-34074964 ATCTCCCCCAAGGCGAGGTCAGG + Intronic
909279805 1:73735304-73735326 ATTTTCCTTAGTCAGAGGTCTGG + Intergenic
911101456 1:94098954-94098976 ATGTCCTTCAGCGCCAGGTCCGG + Exonic
911922430 1:103782812-103782834 ATTTCCCTCAGCCCTAGGACTGG - Intergenic
915116417 1:153603499-153603521 ATCTCCCTCAGTGCAAGAGCAGG + Intergenic
919310227 1:195897159-195897181 ATGAACCTCAGTGCTAGGTCTGG - Intergenic
1067760569 10:49042503-49042525 CTTTGCCTCAGTGCGGAGTCTGG - Intronic
1078662025 11:13295465-13295487 ATGTCCCTGATTGCAAGGTCTGG + Intronic
1082740929 11:56910318-56910340 ATTTACCTCCGTGGGTGGTCTGG - Intergenic
1098508440 12:71282615-71282637 CTTACCCTCAGTGCGGGGTGTGG + Intronic
1105041779 12:132966779-132966801 ATTTCCCAGCCTGCGAGGTCAGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107466653 13:40657060-40657082 GTTTCTCTGAGTGCGAAGTCAGG - Intronic
1112345366 13:98584823-98584845 ATTTCCCCCATTGCCAGGCCTGG - Intergenic
1116858067 14:49971280-49971302 ACTTCCCCCAGGGCAAGGTCAGG - Intergenic
1117273675 14:54170522-54170544 ATTTCCCTCTTTGCTAGGTGGGG - Intergenic
1117671698 14:58114192-58114214 ATTTCCTTCTGTGGGAAGTCAGG + Intronic
1118000899 14:61522620-61522642 TCTTCCCCCAGTGCTAGGTCAGG + Intronic
1128249637 15:66155322-66155344 ATTTGCCTCAGAGTGAGGGCGGG + Intronic
1128533311 15:68470117-68470139 CTTACCCTTAGTGCAAGGTCAGG + Intergenic
1129666961 15:77584743-77584765 ATTTCCCTCAGGACAAAGTCTGG + Intergenic
1129942760 15:79512640-79512662 ATTTGTCTCAGTGTGAGGTGGGG - Intergenic
1130034998 15:80351282-80351304 ATTTCAGACAGTGTGAGGTCTGG - Intronic
1131199183 15:90382255-90382277 ATTTCCTTCAGTGGGAGGCTGGG - Intergenic
1133505517 16:6408429-6408451 ATTTTCATCAGGGCGAGTTCTGG + Intronic
1134359590 16:13518794-13518816 ATTTCTCACAGTTCGAGGTTAGG + Intergenic
1138543248 16:57701244-57701266 ATTTCCTTCAATGGGATGTCAGG + Intronic
1141160805 16:81628076-81628098 ATGGCCCTCAGTGAGGGGTCAGG - Intronic
1145038019 17:19554909-19554931 ATTTCCAACAGTGCAAGGACTGG - Intronic
1147948119 17:44091943-44091965 GTCTCCCTCAGTGGGAGCTCAGG - Intronic
1149337930 17:55656660-55656682 ATGTCCATCAGTGTGAGCTCAGG + Intergenic
1160363561 18:78305109-78305131 ATTTCCTTCAGTCCCAGGTAGGG + Intergenic
1164054727 19:21612846-21612868 ATTTCCCTCACTGCTATCTCAGG + Intergenic
925043152 2:749517-749539 TTTCCCCCCAGTGCGAGGACAGG - Intergenic
925735389 2:6959085-6959107 AACTCCCTCAGTGAGAGGACAGG + Intronic
925996296 2:9296264-9296286 AATTCCCTCACTTCTAGGTCAGG - Intronic
927888053 2:26730566-26730588 ATTTCCCTGAATGCCAGGGCTGG - Exonic
928031147 2:27780483-27780505 ATTTCCCTCAGAGCCAGGTTTGG - Intronic
940901746 2:159132173-159132195 ATTTCCCTCATTTTTAGGTCAGG - Intronic
944070671 2:195665026-195665048 ATTTAGCCCAGTGTGAGGTCGGG + Intronic
945449542 2:209978031-209978053 ATATCCCTCAGTTCTATGTCAGG - Intronic
947488612 2:230574972-230574994 ATTTCCCAAAGTGCCAGGTGAGG + Intergenic
1170384704 20:15803609-15803631 ATTTCCCACAGTGCAAGGCCTGG + Intronic
1171371457 20:24665040-24665062 AGTTCCATCAGTGTGGGGTCTGG - Intronic
1184953114 22:47860217-47860239 ATTTCCCTCTGGGAGAGGTTTGG + Intergenic
966961222 3:184941459-184941481 ATTTCCCTCAGAGTCAGTTCGGG + Intronic
971181217 4:24330173-24330195 ATTTCTCTCATTGAGAGGTGGGG + Intergenic
971590249 4:28458355-28458377 AATTCCCTAAGAGTGAGGTCAGG - Intergenic
976568211 4:86576857-86576879 TTTTCCCTCAGTGGAAGGTTTGG - Intronic
983098273 4:163592534-163592556 TTTTCCATCAGTGTGATGTCTGG - Intronic
984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG + Intergenic
1008661259 6:53670591-53670613 TTTTCCCACTGTGTGAGGTCAGG + Intergenic
1019965118 7:4492234-4492256 ATTTTACACAGTGTGAGGTCAGG - Intergenic
1024617639 7:51128916-51128938 ATTTCCCTCAGTGCGAGGTCGGG - Intronic
1026824028 7:73570235-73570257 ATTCTCCTCAGTGCCAGGTGGGG + Exonic
1029571473 7:101372492-101372514 ATTTCCCTAAGTATGTGGTCAGG - Intronic
1033285772 7:140039441-140039463 TTTGCCCTCAGTGGGAGGTTTGG + Intronic
1038495452 8:27999028-27999050 ATTTCCCTCAGTGCATGCTGTGG - Intergenic
1038896812 8:31792751-31792773 ATCTCCCTCACTGAGAAGTCTGG + Intronic
1043017233 8:74954552-74954574 ATTTCCATTAATGGGAGGTCAGG - Intergenic
1044275510 8:90295206-90295228 ATTTCCCCCAGTGCAAGATTAGG + Intergenic
1044452947 8:92359596-92359618 ATTTCCCTGAGTGTGGGATCTGG - Intergenic
1046620866 8:116528382-116528404 AATTCCCAAAGTGCGTGGTCAGG - Intergenic
1054812065 9:69442785-69442807 ATCTTTTTCAGTGCGAGGTCAGG + Intronic
1056192446 9:84197623-84197645 ATTTCCCTTAGTGCAAATTCTGG + Intergenic
1059995334 9:119903349-119903371 ATCTCCCTCAGTATGAGGTCAGG - Intergenic
1197634557 X:128900489-128900511 ATTGCCCTCAGTTGGAGGGCTGG + Intergenic
1198012105 X:132567990-132568012 ATTTCCCTCACAGCCAGGTGTGG - Intergenic