ID: 1024618684

View in Genome Browser
Species Human (GRCh38)
Location 7:51138342-51138364
Sequence CCACCTCCATGGCAACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024618678_1024618684 4 Left 1024618678 7:51138315-51138337 CCATGCAAAATAAACTCTGCCTT 0: 1
1: 0
2: 2
3: 27
4: 312
Right 1024618684 7:51138342-51138364 CCACCTCCATGGCAACAGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024618684 Original CRISPR CCACCTCCATGGCAACAGGG AGG Intronic
902174693 1:14640318-14640340 CCTCCTCCATGGCAACAGAATGG - Intronic
902700378 1:18168095-18168117 CCACCCCAAAGGCAGCAGGGTGG - Intronic
902830729 1:19010624-19010646 ACACCTCCATGGCCCCAGGGAGG + Intergenic
903212284 1:21824853-21824875 CCACCTCCACGCCAACATGCAGG + Exonic
908027849 1:59970433-59970455 CTTCCTTCATGGTAACAGGGCGG - Intergenic
908255497 1:62300108-62300130 CCCCCTCCAGGGCAAAAGTGAGG + Intronic
912638112 1:111318016-111318038 CGACCTCCATGGCTCCTGGGAGG + Exonic
913527961 1:119712196-119712218 CAACCTCCATGGAAAAAGGCTGG + Intronic
914253053 1:145937687-145937709 CTACTACCAGGGCAACAGGGAGG - Exonic
915612260 1:157003956-157003978 TCACCACCATGGGAAAAGGGGGG + Intronic
915979238 1:160409825-160409847 CCACCTCCATGGCTGAAGGTGGG + Intronic
916047718 1:161013257-161013279 CCAGCTCCCTGGCAACTGGGGGG - Intronic
919465328 1:197917907-197917929 CCACATCCAAGGCATCATGGAGG + Exonic
919510053 1:198450916-198450938 CCCCATCCCTGCCAACAGGGAGG - Intergenic
920103612 1:203534713-203534735 TCACCTCCTTGGCAGCCGGGAGG + Intergenic
921581641 1:216902527-216902549 CTACCTCCATGACAAAAGAGAGG + Intronic
922724071 1:227914487-227914509 CCACATCCATGGCAACAGCTGGG - Intergenic
922995085 1:229950725-229950747 CAACCTCTATGGAAACAGTGTGG - Intergenic
924250717 1:242130522-242130544 CAACCTCTATGGAAACAGTGTGG - Intronic
1065188152 10:23188958-23188980 CCAGGCCCAAGGCAACAGGGTGG + Intergenic
1065356560 10:24847235-24847257 CTACCTCTATGACAAAAGGGAGG + Intergenic
1067215455 10:44298861-44298883 CAACCTCCAGGACAACAGGCAGG + Intergenic
1068967201 10:62924562-62924584 CCAACTCCAAGGGAACAGGGAGG + Intergenic
1070717770 10:78734938-78734960 TCACCTCCACGGCAGCAGGGTGG + Intergenic
1070963485 10:80515595-80515617 CCTCCTCCATGGCAACATGATGG - Intronic
1076189459 10:128472696-128472718 ACTCCTCCATGGCATCAGGATGG + Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077446007 11:2591234-2591256 CCACCTCCTTGGCAGGAGGCTGG + Intronic
1078104603 11:8350833-8350855 TCACTTCCGTGGCTACAGGGTGG - Intergenic
1078896900 11:15604863-15604885 TCACCTCAGTGGCACCAGGGAGG - Intergenic
1079008459 11:16809466-16809488 CCCCCTCCAAGGAACCAGGGGGG + Intronic
1080428671 11:32178830-32178852 CCAGCTCCTTGGTAACAGGTGGG + Intergenic
1083988219 11:66230790-66230812 CCACCTCCCTGGCAGCAAAGTGG + Exonic
1084086651 11:66858047-66858069 CCACCTTGACGGCAACAGGCTGG + Exonic
1084330114 11:68425201-68425223 CCACCACCAGGGCCACAGGGCGG - Exonic
1084968803 11:72758310-72758332 CCACCTCTGTGGCAAGTGGGTGG - Intronic
1085707253 11:78797679-78797701 CTACCTCCCAGGCAACTGGGAGG + Intronic
1087100480 11:94359114-94359136 CCAACTGCAAGGCAACAAGGAGG + Intergenic
1088401882 11:109430338-109430360 CCACCTTCATGGAAAAGGGGAGG - Intergenic
1089012273 11:115141071-115141093 TCACCTACATGGCAGCAGGAAGG - Intergenic
1089054578 11:115575222-115575244 CCACTTCCATGGCAACACCCTGG - Intergenic
1092063878 12:5573420-5573442 CCACCTCCATGTCCAATGGGAGG - Intronic
1092357409 12:7808086-7808108 CCAGCAACATGGCACCAGGGAGG + Intergenic
1096951933 12:55482308-55482330 CCATCTCCATGACAACAGCTAGG - Intergenic
1097198210 12:57256236-57256258 CGACCCCCATGCCAAGAGGGAGG - Intronic
1097760633 12:63459957-63459979 CCACATCCATAGGAAAAGGGGGG + Intergenic
1102974636 12:117197696-117197718 CAAACTCCATGGCAGCGGGGAGG + Intergenic
1103239722 12:119403248-119403270 CCACCTCCCTGGCTGCAGGGAGG - Intronic
1104634367 12:130428315-130428337 TCGTCTCCATGGCAACAGTGCGG + Exonic
1106958797 13:34973762-34973784 CCACTTCCATGGCACCACAGAGG - Intronic
1110725613 13:78819520-78819542 CCACCTCCTTCACAACAGGAGGG + Intergenic
1111265250 13:85802420-85802442 CCACATCCATGAAAGCAGGGAGG - Intergenic
1112037390 13:95509351-95509373 CCATCTTTATGGCCACAGGGAGG - Intronic
1114080586 14:19199369-19199391 CCTCCTCAAGGGCCACAGGGTGG + Intergenic
1116774826 14:49167332-49167354 CAAGCTCCATGACACCAGGGAGG - Intergenic
1117015136 14:51510105-51510127 CTCCCTCCATGGCAACAAGATGG - Intronic
1117742861 14:58835854-58835876 CCAGCTCCAGGGCTACATGGTGG - Intergenic
1118076767 14:62308112-62308134 ACAGCTCCAAGGCAACAGGGAGG - Intergenic
1118747412 14:68784395-68784417 CCACCTGCAAGGCAGCAAGGGGG + Intergenic
1121011593 14:90523142-90523164 ACACCTCCCTGGGAGCAGGGAGG - Intergenic
1121627016 14:95393125-95393147 CCACCTCCATGAGAACATGCTGG - Intergenic
1121762849 14:96460614-96460636 CAACCTCTATGGCAAAGGGGTGG - Intronic
1121778857 14:96608821-96608843 CCACCTCCGTGGCCACAGTGAGG - Intergenic
1122847318 14:104506939-104506961 CCAGCCCCATGGCAACCTGGGGG - Intronic
1125145378 15:36461353-36461375 CAACCTCTATGGAAACAGTGTGG - Intergenic
1125370350 15:38969263-38969285 CCACATCCATGCCAACACTGTGG - Intergenic
1126048098 15:44663285-44663307 CCACCTCTATGGCTGCAGGGAGG + Intronic
1128901176 15:71423901-71423923 CTCCCTCCATGGCAACAGCTGGG + Intronic
1129616046 15:77099316-77099338 CCTACTCCATGTCACCAGGGAGG - Intergenic
1129716919 15:77857618-77857640 CCAGCTTCATGGCCACGGGGAGG + Intergenic
1132278616 15:100592512-100592534 CCACCTAGATGGCTACAGGATGG - Intronic
1132489907 16:222196-222218 CCATCTACACAGCAACAGGGAGG + Intronic
1133490910 16:6267058-6267080 CCACCTCTATGGAAACATGGTGG + Intronic
1133983831 16:10653077-10653099 CCAACTTCATGGGAACAGGAAGG - Intronic
1134386881 16:13781693-13781715 CCTCCTCAATGGCAACTGGGAGG - Intergenic
1134466903 16:14486945-14486967 TCACCTCCAGGGAAACAGGGAGG - Intronic
1137636428 16:49990968-49990990 TCACTGCCATGGCAACTGGGAGG + Intergenic
1137695493 16:50459202-50459224 CCACCGGCACGGCGACAGGGAGG - Intergenic
1138264693 16:55652118-55652140 ACACCTCCATGGCACCAATGAGG - Intergenic
1140039097 16:71393643-71393665 CCACCTTCAGGGAAAGAGGGCGG + Intergenic
1140408990 16:74730110-74730132 CCACCTCCAGAGCAGCTGGGGGG - Intronic
1143574162 17:7780203-7780225 GCACCACCATGGCAATTGGGCGG - Exonic
1144065286 17:11619103-11619125 CCACCTTCACCACAACAGGGTGG - Intronic
1145232438 17:21183906-21183928 CCCACTCCAGGGCAACAGAGAGG - Intronic
1145308445 17:21688349-21688371 CCGACTCCATGGGAGCAGGGAGG + Intergenic
1146596818 17:34176629-34176651 CCATTTCCATGGCAACTGGGAGG - Intergenic
1147311926 17:39600550-39600572 ACCCCTCCATGACAACAGAGGGG - Intergenic
1147322138 17:39652986-39653008 CCTAATCCATGGCAACTGGGAGG - Intronic
1148450648 17:47775699-47775721 CCCACTCCATGCCAAGAGGGTGG + Intergenic
1148490164 17:48018297-48018319 GCACCTCCATGGGAACACGAAGG - Intergenic
1148588389 17:48797272-48797294 CCAACTCCATGGAAACAAGGCGG - Intronic
1151306016 17:73263064-73263086 CCAGCTCCAGGGCTAGAGGGTGG + Intergenic
1151354998 17:73553130-73553152 CCACCTCCATGCCCAGAGTGGGG - Intronic
1152267968 17:79307189-79307211 CCAGCTGGATGGCAACAGGGCGG - Intronic
1153509043 18:5832643-5832665 CCACATCCATGGAACCTGGGGGG - Intergenic
1155991973 18:32287396-32287418 CAATCTCCATGGCAACAGTGAGG - Exonic
1157489527 18:48113118-48113140 CCATTTTCATGGCAACAGGAAGG - Intronic
1157827158 18:50822766-50822788 CCACCTCCTTAGCCACAGGTTGG + Intronic
1160087131 18:75786898-75786920 CCATCGCCATGGCAACACGGAGG - Intergenic
1160962994 19:1732613-1732635 CCACGTCCAAGGGCACAGGGTGG + Intergenic
1161976500 19:7610690-7610712 CCACCTCCAGGTCAACTTGGTGG + Exonic
1162926048 19:13930945-13930967 CCACTTCCAGGGGAACCGGGGGG - Intergenic
1163669046 19:18617074-18617096 GCACCTCCAGGGCTTCAGGGTGG - Exonic
1167349816 19:48967590-48967612 CAACTTGCATGGCAACCGGGGGG + Intergenic
1167749401 19:51370800-51370822 TCCCCTCCATGTCTACAGGGGGG + Intergenic
1168108658 19:54179944-54179966 CCATCTCCCTAGCAACACGGGGG + Intronic
925282028 2:2691335-2691357 CCACTTCCATGAGAACAGGACGG - Intergenic
926679534 2:15653207-15653229 CCACCCACAGGGCAGCAGGGAGG - Intergenic
929419555 2:41776998-41777020 CCACCCTCATGGCAACAGTCTGG + Intergenic
932404657 2:71505098-71505120 CTGCCTCCTGGGCAACAGGGAGG - Intronic
932568736 2:72925475-72925497 CCACCTCCAGGGCAGCAGCTAGG - Intronic
932793171 2:74673438-74673460 CCCCCTGCAGGGCGACAGGGAGG - Exonic
933097107 2:78199096-78199118 CCTCCTCCAGGGCAAAATGGAGG + Intergenic
936125869 2:109788780-109788802 CCAGCTCCATGGCAACCTGATGG - Intergenic
936218824 2:110582688-110582710 CCAGCTCCATGGCAACCTGATGG + Intergenic
944688607 2:202139687-202139709 GCAGCTCCTTGGCAGCAGGGAGG - Intronic
948338971 2:237233801-237233823 CCAGGTCCATAGCAACAGAGAGG + Intergenic
948371239 2:237490240-237490262 CGACCTCCATGGGCTCAGGGAGG - Intronic
1170314444 20:15028089-15028111 CCACATCCCTAGCAAAAGGGAGG + Intronic
1171196066 20:23200627-23200649 CCGCGTGCAGGGCAACAGGGTGG + Intergenic
1172015286 20:31869647-31869669 CCACCCCCAGGGCAGCTGGGGGG + Intronic
1174011584 20:47454135-47454157 CCTCCTCTATTGCACCAGGGTGG - Intergenic
1174035593 20:47666432-47666454 CCACCTCGATGGCCACTGAGCGG + Exonic
1177276973 21:18924556-18924578 CCACCTCCGTTGTAAAAGGGAGG - Intergenic
1180500192 22:15923315-15923337 CCTCCTCCAGGGCCACAGGGTGG - Intergenic
1180840898 22:18958385-18958407 CCATCTCCATGGCAACGCGTGGG - Intergenic
1180843355 22:18969439-18969461 CCACCTCCATGGCCAGGGGCAGG + Intergenic
1181027874 22:20136065-20136087 CCTCCTCCAGGGCCACAGGCAGG - Intronic
1181058118 22:20269296-20269318 CCACCTCCATGGCCAGGGGCAGG - Intronic
1181060592 22:20280389-20280411 CCATCTCCATGGCAACGCGTGGG + Intronic
1181447618 22:22990154-22990176 CCACCGCCATGGCAACACCGGGG - Intergenic
1181514660 22:23403745-23403767 CCACCTCCATGGCCAGGGGCAGG - Intergenic
1181573252 22:23779195-23779217 CCACCTCCATGCCGAGAGGAGGG + Exonic
1185274478 22:49944404-49944426 CCTCCTCCATGGCCAGAGTGAGG - Intergenic
1185345120 22:50307613-50307635 CCGTCTCCATGGCAGCAGCGCGG - Exonic
949922503 3:9014006-9014028 CCATCTCCCTAGCTACAGGGAGG + Intronic
950142464 3:10624928-10624950 CCCCCACCATGGCACCAGGCTGG + Intronic
952583519 3:34863967-34863989 CCACCTCCAGGGCAGTAGTGTGG - Intergenic
953051393 3:39347508-39347530 CCACCTGCATGACAAAAGAGTGG + Intergenic
955397517 3:58567473-58567495 CCACCTCCAAGGCTACAGGGAGG - Intronic
956637688 3:71382475-71382497 CCATCTCCCTGGCCACAGGGAGG + Intronic
958269418 3:91480593-91480615 TCACCACAATAGCAACAGGGTGG + Intergenic
960997161 3:123347855-123347877 TCATCTCCATGGCAACATGACGG + Exonic
961521065 3:127467578-127467600 CCGCCCCCATTGCATCAGGGCGG - Intergenic
964074814 3:152680827-152680849 CCTCCACCATGCCAACAGTGTGG - Intergenic
966885586 3:184376315-184376337 CCGCCTCCATGGCCCCAGGAAGG - Exonic
970191212 4:13521399-13521421 CCACCTCCATGGATGGAGGGAGG - Intergenic
970568423 4:17355007-17355029 CTACATCCATGACAACAGTGTGG + Intergenic
970822877 4:20239426-20239448 CCACCTCCATTGTACCAGGAGGG + Intergenic
972570195 4:40303607-40303629 CCAACACCATGGCTACAGGGAGG - Intergenic
973737363 4:53885741-53885763 CCAGCTCCAGGGCTCCAGGGAGG - Intronic
977734835 4:100401499-100401521 CCACCTCCATGAATACAGAGAGG + Intronic
978859897 4:113436018-113436040 CTATCACCATGGCAGCAGGGCGG + Intergenic
980341198 4:131549374-131549396 CCACCTACATGGGAACAGGGAGG + Intergenic
983807861 4:172017719-172017741 CCAACTCTATGGGAAGAGGGAGG - Intronic
983850190 4:172570615-172570637 CAACCTTTATGGCACCAGGGAGG + Intronic
989037257 5:37188516-37188538 CCACATCCATGCCAACATGGAGG - Intronic
990445357 5:55888821-55888843 CCACCTCCATCTCACCAGGCTGG + Intronic
990489951 5:56294874-56294896 CCACATCCATGGCAAAATGAGGG - Intergenic
994261545 5:97665252-97665274 CTTCCACCATGGCATCAGGGAGG + Intergenic
997019619 5:129983618-129983640 CCAACTACATGGCAAGAGAGAGG + Intronic
997445253 5:133935579-133935601 CCACCATCCTGGCAGCAGGGTGG + Intergenic
1000906823 5:166974435-166974457 CCACATCCATTTGAACAGGGAGG - Intergenic
1004669308 6:17780771-17780793 CTAACTCCATAGCAGCAGGGTGG + Exonic
1004674715 6:17830541-17830563 CGACCACAGTGGCAACAGGGCGG + Intronic
1005332286 6:24761595-24761617 CCTCCTCCAAGAGAACAGGGAGG + Intergenic
1006634214 6:35450777-35450799 CCACCTGAAAGGGAACAGGGAGG - Intergenic
1008459196 6:51748327-51748349 CAACCTCCATGGCAACGTTGTGG - Exonic
1009173766 6:60433699-60433721 TCACCACAATAGCAACAGGGTGG - Intergenic
1009249177 6:61276864-61276886 CCACCTCCATGGTAAGGGGCAGG + Intergenic
1010021118 6:71161143-71161165 ACACCTCAATGGCAATATGGGGG - Intergenic
1011082677 6:83507026-83507048 CCACCTCCATGGCTACTGCCTGG + Intergenic
1018034918 6:159873727-159873749 CAAACTCCATGGCACCAGGCAGG + Intergenic
1018163809 6:161074957-161074979 CAGCCTCCATGGCAACAGTGAGG - Intronic
1018424327 6:163667004-163667026 CCACCTATATGGCATCAAGGAGG + Intergenic
1018442325 6:163824578-163824600 CCATCTCCACGCCAACAGGGCGG + Intergenic
1019307939 7:344698-344720 TCTCCTTCATGGAAACAGGGAGG - Intergenic
1023009501 7:35913226-35913248 CCACATCAATGGCAACAGGTGGG + Intergenic
1024278404 7:47697809-47697831 CCACCTCCCTGGCACCTGGAAGG - Intronic
1024547150 7:50531696-50531718 CCACCCCGATGCCACCAGGGTGG + Intronic
1024618684 7:51138342-51138364 CCACCTCCATGGCAACAGGGAGG + Intronic
1025123171 7:56323379-56323401 CCACATCAACGGCAACAGGTGGG + Intergenic
1026900441 7:74033933-74033955 CCATCGCCATGGCAACAGACAGG - Intronic
1035655341 8:1301086-1301108 CCTCTTCCATGGCCAGAGGGCGG - Intergenic
1035927872 8:3748393-3748415 CCACTGCCATGGAAACAGGCAGG + Intronic
1036487686 8:9194400-9194422 ACACAGCCATGGCAACAGAGAGG - Intergenic
1036501589 8:9319391-9319413 TCAGCTCCAGGGCAGCAGGGAGG + Intergenic
1036713511 8:11099112-11099134 CCACCTCCCTGGGAAGAGGCAGG + Intronic
1037420170 8:18693649-18693671 CCACCACAACTGCAACAGGGGGG - Intronic
1037762081 8:21748216-21748238 CCACCTTCATGGCAACACATAGG - Intronic
1039948502 8:42150275-42150297 CCACCTCCATGGCTACAGCCTGG + Intergenic
1040066804 8:43151954-43151976 CAACCTCCAAAGCTACAGGGAGG - Intronic
1040934536 8:52768620-52768642 CCTCCTCCCTGGCCAAAGGGAGG + Intergenic
1042517475 8:69674684-69674706 CCAACTCCACGGCATCAGAGAGG + Intronic
1043472841 8:80578758-80578780 GCGCCTCCATAGCAACAGCGTGG - Intergenic
1044150351 8:88769428-88769450 CCACCACAAGGGCAAAAGGGAGG - Intergenic
1047697311 8:127416217-127416239 CCAGCTTCACGGCACCAGGGGGG - Exonic
1049636064 8:143690096-143690118 CCATGTCCATGGGAACAGCGAGG - Exonic
1051158403 9:14176866-14176888 CCACCTTCAAGTCAACAGTGGGG + Intronic
1051198253 9:14587438-14587460 CCTCCCCCATGGGAAAAGGGAGG - Intergenic
1051697594 9:19786315-19786337 CCACCTTCATGGCTGCAGGAGGG - Exonic
1051771823 9:20587461-20587483 CCACCTCCAAGACAAGAGAGGGG + Intronic
1051944312 9:22548618-22548640 GCCCCTCTATGGCAACAGGAGGG - Intergenic
1052991701 9:34522600-34522622 ACACGTCCATGGGAACAGAGGGG - Intronic
1053168073 9:35858710-35858732 CCAACACAATGGCAACAGGAAGG - Intergenic
1053278140 9:36798634-36798656 CCACTGCCAAGCCAACAGGGAGG - Intergenic
1053667787 9:40328555-40328577 CCAGCTCCATTGCAACAGTTGGG + Intronic
1054378932 9:64468594-64468616 CCAGCTCCATTGCAACAGTTGGG + Intergenic
1054516824 9:66047728-66047750 CCAGCTCCATTGCAACAGTTGGG - Intergenic
1056911599 9:90706153-90706175 CCACATCCATGGCCCCAGAGGGG - Intergenic
1056970431 9:91196461-91196483 CCACCACCCTGGCCACAGGGAGG + Intergenic
1057569681 9:96194961-96194983 CGTCCTCCATGGCAATAGGAAGG - Intergenic
1059325884 9:113503783-113503805 CCCCCTCCATGGAACCAGCGGGG - Intronic
1059487464 9:114637764-114637786 CCAGCTCCATGACCACAGGCCGG - Intronic
1060106355 9:120875960-120875982 CCAGCGCCATGGCCACAAGGAGG - Intronic
1060225127 9:121785825-121785847 CCACCTCCTGGGAGACAGGGTGG + Intergenic
1060533318 9:124362380-124362402 CCACCTCCATGCCAGGAGGAAGG + Intronic
1061638953 9:131936354-131936376 CCACCTCGAGGGCCACAGTGAGG + Intronic
1186177990 X:6945073-6945095 CCACCTGCAAGCCATCAGGGAGG + Intergenic
1189315917 X:40056478-40056500 CCAGCTCCATGGACACAGGTAGG - Intronic
1190023889 X:46904227-46904249 CCACTGACATGGCAACAGTGGGG - Intergenic
1190258866 X:48785843-48785865 CCGCCTCCAAGGCAGCATGGCGG + Intergenic
1192955645 X:76067598-76067620 CCTCATCCATTGCAACAGAGTGG - Intergenic
1193578601 X:83233291-83233313 CCACATCCATAGGAAAAGGGGGG + Intergenic
1196530714 X:116783001-116783023 CCACATCCATAGGAAAAGGGAGG + Intergenic
1199738771 X:150711701-150711723 CCAGCTGCATGGCCAAAGGGGGG - Intronic
1201413869 Y:13728312-13728334 GAACATCCATGGCAACAGAGTGG - Intergenic