ID: 1024619710

View in Genome Browser
Species Human (GRCh38)
Location 7:51146973-51146995
Sequence GGTGATGGGGAGCCAGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024619692_1024619710 29 Left 1024619692 7:51146921-51146943 CCCTGGCAGCCCCAGGAGGGGTG 0: 1
1: 0
2: 3
3: 42
4: 430
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619702_1024619710 -9 Left 1024619702 7:51146959-51146981 CCCACCTTGGGCATGGTGATGGG 0: 1
1: 0
2: 0
3: 20
4: 187
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619696_1024619710 18 Left 1024619696 7:51146932-51146954 CCAGGAGGGGTGTGACATTCTCA 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619700_1024619710 -8 Left 1024619700 7:51146958-51146980 CCCCACCTTGGGCATGGTGATGG 0: 1
1: 0
2: 3
3: 14
4: 159
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619693_1024619710 28 Left 1024619693 7:51146922-51146944 CCTGGCAGCCCCAGGAGGGGTGT 0: 1
1: 0
2: 1
3: 40
4: 390
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619694_1024619710 20 Left 1024619694 7:51146930-51146952 CCCCAGGAGGGGTGTGACATTCT 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619704_1024619710 -10 Left 1024619704 7:51146960-51146982 CCACCTTGGGCATGGTGATGGGG 0: 1
1: 0
2: 5
3: 31
4: 198
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619691_1024619710 30 Left 1024619691 7:51146920-51146942 CCCCTGGCAGCCCCAGGAGGGGT 0: 1
1: 0
2: 6
3: 39
4: 340
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data
1024619695_1024619710 19 Left 1024619695 7:51146931-51146953 CCCAGGAGGGGTGTGACATTCTC 0: 1
1: 0
2: 3
3: 10
4: 126
Right 1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024619710 Original CRISPR GGTGATGGGGAGCCAGCAGG GGG Intronic
No off target data available for this crispr