ID: 1024621864

View in Genome Browser
Species Human (GRCh38)
Location 7:51166551-51166573
Sequence TTCAAACTATTCCAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 5, 2: 23, 3: 93, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024621861_1024621864 11 Left 1024621861 7:51166517-51166539 CCAAACATTTAAACAAGAACTAA 0: 5
1: 329
2: 754
3: 1241
4: 2043
Right 1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG 0: 1
1: 5
2: 23
3: 93
4: 508
1024621860_1024621864 12 Left 1024621860 7:51166516-51166538 CCCAAACATTTAAACAAGAACTA 0: 1
1: 5
2: 12
3: 88
4: 572
Right 1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG 0: 1
1: 5
2: 23
3: 93
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024621864 Original CRISPR TTCAAACTATTCCAAAAAAC AGG Intronic
901479236 1:9513084-9513106 TTTAAACTATTAAAAAAAAAGGG - Intergenic
904981867 1:34510635-34510657 TTAAAACTTTTACAAAACACTGG + Intergenic
905073841 1:35251974-35251996 CTCAAACTCTTCTAAAAAATTGG - Intergenic
906836597 1:49089692-49089714 CTGAAACTATTCCAAAAAATTGG + Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
907264297 1:53247168-53247190 TTCAAACTATCCTAAGAGACAGG + Intronic
908666557 1:66497804-66497826 TTTCAACTTTCCCAAAAAACAGG + Intergenic
909403950 1:75265202-75265224 TTCAAACTATTCCAGAAAATTGG + Intronic
909679438 1:78275425-78275447 TTCAAAATGGTCCAAAAATCTGG + Intergenic
909841695 1:80335589-80335611 CTCAAACCATTCCAAACAATAGG + Intergenic
910407241 1:86901752-86901774 CTAAAATTATACCAAAAAACTGG + Intronic
910786673 1:91006488-91006510 CTCAAACTCTTCCAAAAAATAGG + Intronic
912183872 1:107251091-107251113 TTCAAATCATTCCAAATCACTGG + Intronic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
913663420 1:121025509-121025531 CTAAAACTATTCCAAAAAATTGG + Intergenic
913959083 1:143325705-143325727 CTCAAACTATTTTGAAAAACAGG + Intergenic
914014811 1:143808777-143808799 CTAAAACTATTCCAAAAAATTGG + Intergenic
914053400 1:144151085-144151107 CTCAAACTATTTTGAAAAACAGG + Intergenic
914125797 1:144815456-144815478 CTCAAACTATTTTGAAAAACAGG - Intergenic
914163010 1:145152430-145152452 CTAAAACTATTCCAAAAAATTGG - Intergenic
914653432 1:149717334-149717356 CTAAAACTATTCCAAAAAATTGG + Intergenic
915043368 1:152987630-152987652 CTCAAACTATTTCAGAAAATTGG + Intergenic
915810795 1:158908107-158908129 CTGAAACTGTTCCAAAAATCTGG + Intergenic
916772115 1:167920044-167920066 TTGTAATTATTCCAAAAAATTGG - Exonic
917049833 1:170908828-170908850 TTCAAACTATAATAAAATACTGG + Intergenic
917112744 1:171567234-171567256 TTCCAACTATGAAAAAAAACTGG - Intronic
917449512 1:175135428-175135450 CTCAAACTATTTCAGAAAAGGGG + Intronic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
918031650 1:180819250-180819272 TTCAAAATGGTTCAAAAAACAGG - Intronic
919326565 1:196114660-196114682 ATCAGACTTTTCTAAAAAACAGG + Intergenic
919424104 1:197407411-197407433 TTTAAACTGTTCCTAAAAAATGG - Intronic
921200820 1:212804155-212804177 TTAAAAATATTCACAAAAACAGG - Intronic
922302963 1:224319264-224319286 CTCAAATTATTCCCAAAAAATGG + Intronic
922580574 1:226694921-226694943 TTCCAACTCTTTCAAAAAGCTGG + Intronic
1063284330 10:4667410-4667432 CACAAACTCTTCCAAAAAAGTGG - Intergenic
1063507820 10:6617511-6617533 TTCAAAGCACTCCAAAAACCTGG - Intergenic
1065111901 10:22448579-22448601 TTCAAACTACACAAAGAAACGGG + Intronic
1066014892 10:31231444-31231466 CTGAAACTATTCCAAACAATTGG + Intergenic
1066110972 10:32196568-32196590 CTCAAACTCTTTCAAAAAAATGG - Intergenic
1066963028 10:42237859-42237881 CTCAAACTATTTTGAAAAACAGG + Intergenic
1068055559 10:52008731-52008753 TTGAAACTGTTCCAAAAAACTGG - Intronic
1068058901 10:52041521-52041543 TTCAAACCATTCCAGATAACTGG - Intronic
1068511299 10:57968861-57968883 TTCAAACTATTTAAAAACAGTGG + Intergenic
1068642068 10:59420599-59420621 CTCAAACTCTTCCAAAAAATAGG + Intergenic
1069050871 10:63792211-63792233 CTCAAACTACTGCAAAAAATAGG + Intergenic
1069072318 10:64001923-64001945 CTGAAACTACTCCAAAAAATTGG + Intergenic
1069247831 10:66230321-66230343 TTAAAACTATTACATAAAATTGG - Intronic
1069730136 10:70605942-70605964 TTGGAACTATCCCAAAAAGCAGG - Intergenic
1070073658 10:73114371-73114393 TGCAAGCTATTCCACAATACAGG - Exonic
1070485406 10:76925739-76925761 TTCATACTAAACCAAACAACTGG - Intronic
1070632868 10:78100252-78100274 CTGAAACTATTCCAAACAATAGG + Intergenic
1070870881 10:79751568-79751590 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071637807 10:87273779-87273801 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071657437 10:87464171-87464193 TAAAAACTATTCCAAAAAACTGG - Intergenic
1072380354 10:94862467-94862489 CTCAAAAGATTCCAAGAAACAGG + Intergenic
1072863080 10:99027558-99027580 TTCAAACTATTCTGAAAAATAGG + Intronic
1073350530 10:102816507-102816529 TCCAAAGTATTCCAAACATCAGG - Intergenic
1073648604 10:105334500-105334522 TTCAATCAATTCTAAAAGACTGG - Intergenic
1073866237 10:107807574-107807596 TTCAAACTATTCCTAATCATAGG - Intergenic
1074217985 10:111406718-111406740 TTCACACTATACCCAAAGACAGG - Intergenic
1074357528 10:112799349-112799371 GTCAAAGTTTTCCAAAACACTGG - Intronic
1074820428 10:117174333-117174355 TTCAGACTATTCTAAGATACAGG + Intergenic
1075279792 10:121129693-121129715 TTCAAACAATTCAATGAAACAGG + Intergenic
1075703585 10:124484797-124484819 TGCAAACTGTTCCAAAGAGCAGG - Intronic
1076269490 10:129139046-129139068 TTCAAGATATTCAAAAAAATCGG - Intergenic
1077949179 11:6936582-6936604 CTCAAACTCTTCCAAAAAATAGG + Intronic
1077963261 11:7098050-7098072 TTCAAGATATTCCATGAAACAGG + Intergenic
1078299815 11:10117070-10117092 TTCAAGCTAGTCAAAAAACCAGG + Intronic
1078908376 11:15708393-15708415 TTCAAACTCTTCTGAGAAACAGG + Intergenic
1078987370 11:16608694-16608716 TTCAAATTATTATAAATAACAGG + Intronic
1079178825 11:18170396-18170418 TGGAAACTATTCCAAAAATAAGG + Intronic
1079270457 11:18980414-18980436 GTCAACCTAATACAAAAAACAGG - Intergenic
1079814293 11:25036010-25036032 CTGAAACTATTCCAAAAAGCTGG - Intronic
1080083962 11:28256238-28256260 CTCAAACTATTCTAAGAAAGAGG - Intronic
1080212850 11:29807150-29807172 TTCTAACTATTACAAAAAGCAGG + Intergenic
1080293386 11:30697241-30697263 TGCAAACTGTTGGAAAAAACTGG - Intergenic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1081295883 11:41388749-41388771 TCTAAACTATACCAAAAGACAGG + Intronic
1081358993 11:42148902-42148924 TTCAATGTATTCCCAAATACAGG + Intergenic
1082558037 11:54586267-54586289 ATCAAACTACTCCAAGCAACAGG - Intergenic
1082865152 11:57892965-57892987 CTCAAACTATTCCAGAAAATTGG - Intergenic
1082917738 11:58456511-58456533 CTCAAACTATTCCAAAAGATTGG + Intergenic
1084490121 11:69473753-69473775 TACAAACTATCCCAAAACACAGG - Intergenic
1085797047 11:79551487-79551509 ATAAAACTATTTCCAAAAACAGG + Intergenic
1086230397 11:84562515-84562537 CACAAACAATTCCAAAATACAGG - Intronic
1086279363 11:85168538-85168560 TTCAGATTATCCCAAAAAATAGG + Intronic
1086430704 11:86733177-86733199 CACAAACTCTTCCAAAAAATAGG + Intergenic
1087219052 11:95526324-95526346 TTTAACCCATTCCAGAAAACAGG - Intergenic
1087485167 11:98751433-98751455 CTGAAACTATTCCAAACAATAGG + Intergenic
1088076441 11:105854653-105854675 TTCAAAATATATCAAAAACCTGG - Intronic
1088601824 11:111486470-111486492 TTCATACTATTCTAAAAAATTGG + Intronic
1089095559 11:115917397-115917419 TTCAAGCTTTTTCAAAGAACAGG - Intergenic
1089619138 11:119712569-119712591 TTCAAAATCTTCAAAAAAAAAGG + Intronic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1090814049 11:130274904-130274926 TACAAACTCTTCCAAAAAACGGG - Intronic
1091531885 12:1365555-1365577 TTCCAACTATTCCTAAGCACAGG + Intronic
1092085427 12:5754458-5754480 CTTAAAGTCTTCCAAAAAACAGG - Intronic
1093001747 12:14004634-14004656 TTGACACTATTCCACAAAAATGG - Intergenic
1093686707 12:22064266-22064288 TGCATCCTATTCCAAAAAAGGGG + Intronic
1095298395 12:40553479-40553501 ATGAAACTATTCCAAAAAATTGG - Intronic
1095367654 12:41427261-41427283 GTGAAAATATTCCAAAAAACAGG - Intronic
1095879065 12:47113009-47113031 TACAATCTATTACCAAAAACTGG + Intronic
1096346682 12:50853923-50853945 CTAAAACTATTCAAAAAAATTGG + Intronic
1097344493 12:58476357-58476379 TTCAAACTACTCCAAGCTACAGG - Intergenic
1097418866 12:59348922-59348944 CTGAAACTATTCCAAACAATAGG - Intergenic
1097753194 12:63380547-63380569 CTGAAACTATTCCAAACAATAGG + Intergenic
1099024838 12:77452300-77452322 TTCACACTATTCTGAAACACAGG + Intergenic
1099849842 12:88079483-88079505 ATCAAGCTATTACAAAAAACAGG + Intronic
1100048626 12:90415801-90415823 CTCAAAATATGCCAGAAAACTGG - Intergenic
1100226014 12:92556357-92556379 TTCAAAGGATTCCACAGAACAGG - Intergenic
1100946703 12:99792338-99792360 TTCAAACTGTTCTGAAAAATAGG + Intronic
1103172708 12:118835281-118835303 TTCAAAATATTCCCAGAATCTGG - Intergenic
1103519549 12:121528936-121528958 TTGACACTATTCCAAAAGAGAGG + Intronic
1103875617 12:124124940-124124962 TGCAAACTTTTCCAACAAAGAGG - Intronic
1104209466 12:126673808-126673830 TTCAAATTATACCACAAAGCTGG - Intergenic
1104262299 12:127195456-127195478 CTGAAATTATTCCAAAAAAGAGG + Intergenic
1105065826 12:133196372-133196394 TTCAAAGAATTCAAAAAATCAGG - Intronic
1105243322 13:18626644-18626666 TACAAAAAATACCAAAAAACTGG - Intergenic
1107048589 13:36022850-36022872 TATAAACTCTTCCAAAAAAGAGG + Intronic
1107465880 13:40649901-40649923 TTCAAACTATTACAGGAAAGGGG + Intronic
1107575339 13:41713372-41713394 TTTAAACTATTTCAGAACACAGG - Intronic
1108084869 13:46776294-46776316 TGCAAAATATCCCTAAAAACAGG + Intronic
1108109671 13:47055327-47055349 TTCAAACTTTTCCATAAAGATGG - Intergenic
1108130541 13:47294967-47294989 CTGAAACTATTCCAAACAATTGG - Intergenic
1108135743 13:47356324-47356346 CTCAAACACTTCCAAAAAATTGG - Intergenic
1109346560 13:61121708-61121730 CTCAAACTTTTCCAAAAATTTGG + Intergenic
1109717969 13:66241864-66241886 TTCAAATTATTTGAAAAAGCAGG - Intergenic
1109948639 13:69471959-69471981 TTCAATATATTACAAAAAAGAGG + Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1110088580 13:71414504-71414526 TTCAAACTATTCCAAAAAAATGG - Intergenic
1110448402 13:75614357-75614379 TTCAATCTATTCCAACAATAAGG - Intergenic
1110856619 13:80303770-80303792 TTCAAACTATTCCAGAACACAGG - Intergenic
1110985377 13:81960628-81960650 CTGAAACTATTCCAAAACAATGG + Intergenic
1111344460 13:86932448-86932470 CTCAATGTAATCCAAAAAACTGG - Intergenic
1111996233 13:95168504-95168526 TTCACATTATTGCAACAAACGGG - Intronic
1112860710 13:103826818-103826840 CTGAAACTATTCCAAATAATAGG - Intergenic
1113169810 13:107487823-107487845 CTGAAACTATTCCAAAAAATGGG - Intronic
1113954716 13:114091753-114091775 TTCAAACTAATCCAAACAAATGG - Intronic
1114126050 14:19727165-19727187 CTGAAACTATTCCCAAAAATGGG - Intronic
1115293843 14:31803362-31803384 TTCAATGTTTTCCAAAACACTGG - Intronic
1115382291 14:32754545-32754567 TTCAGAATATTCCAATAAAGTGG - Intronic
1115418521 14:33165669-33165691 TTTAAACTAAGCAAAAAAACAGG - Intronic
1115765842 14:36623070-36623092 CACAAACTCTTCCAAAAAATAGG - Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116193251 14:41687003-41687025 CTGAAACTATTCCAAACAATTGG - Intronic
1116274558 14:42814459-42814481 CTCAAACTCTTCCAAAAAAATGG - Intergenic
1116318209 14:43425459-43425481 CTGAAACTATTCCAAACAATAGG + Intergenic
1116549754 14:46221931-46221953 CTAAAAGTATTGCAAAAAACAGG + Intergenic
1116829563 14:49704708-49704730 TTCTAACCATTCCTAGAAACAGG + Intronic
1116840130 14:49811962-49811984 CACAAACTCTTCCAAAAAATAGG - Intronic
1116864676 14:50022083-50022105 TACAAACTATGCCTAAAACCTGG + Intergenic
1116960467 14:50963246-50963268 TTCAATCTATTCCAGCAAATGGG + Intergenic
1117200787 14:53387966-53387988 TTCATTCAATTCCAAAAAATTGG - Intergenic
1117262393 14:54049308-54049330 TTCAAAATAATCCAAAATATAGG + Intergenic
1117502774 14:56370536-56370558 CTAAAACTATTCCAAAAAATTGG - Intergenic
1118073095 14:62267767-62267789 TACTAACTATCCCAAAACACAGG - Intergenic
1119647499 14:76358768-76358790 TTCAAACAATCTCAGAAAACAGG - Intronic
1120383919 14:83819574-83819596 TTCACACAATGCCAAAAAAATGG + Intergenic
1121167216 14:91815706-91815728 TTCAAAATAATCCAAAGGACAGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1202929330 14_KI270725v1_random:24481-24503 CTCAAACTATTTTGAAAAACAGG - Intergenic
1123422965 15:20146737-20146759 CTCAAACTATTTTGAAAAACAGG + Intergenic
1123442037 15:20299576-20299598 CTCAAACTATTTTGAAAAACAGG - Intergenic
1123487976 15:20758001-20758023 TACAAAAAATACCAAAAAACTGG + Intergenic
1123532191 15:21153277-21153299 CTCAAACTATTTTGAAAAACAGG + Intergenic
1123544478 15:21327071-21327093 TACAAAAAATACCAAAAAACTGG + Intergenic
1123757624 15:23409103-23409125 CTCAATCTATTCTGAAAAACTGG - Intergenic
1123829772 15:24123212-24123234 TAAAAATTATTCCAAAAAAGTGG - Intergenic
1123859835 15:24453833-24453855 TACAAATTATTTCAAAAAAGTGG - Intergenic
1123917175 15:25043181-25043203 TCACAACTCTTCCAAAAAACAGG - Intergenic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1125705790 15:41734707-41734729 TTCAAACTTATGCCAAAAACAGG + Intronic
1125775970 15:42214026-42214048 TTAAAAATATGCCAAGAAACTGG + Intronic
1126306559 15:47265155-47265177 TACAAAATCTTCCAAAAAATAGG - Intronic
1126520357 15:49586125-49586147 TTCAAACTATTACAAACTACAGG + Intronic
1126653765 15:50954287-50954309 TGCAAACTCTTCCAGAAAATAGG - Intronic
1127712725 15:61616532-61616554 TTCAAACTCTTCCAAAAATGTGG + Intergenic
1128954277 15:71923406-71923428 TTAAAACTATTTCAGAAAAATGG - Intronic
1129639000 15:77354614-77354636 TTCCAACCATGCCAAAAAACAGG + Intronic
1129749545 15:78051614-78051636 ATCAAAATGTTCCAAACAACTGG + Intronic
1130020073 15:80222330-80222352 TTCAAAATACTCCAAAAAGGGGG - Intergenic
1130166015 15:81460066-81460088 TTTAAACAATTTCAAAAAATTGG - Intergenic
1131034319 15:89211147-89211169 TGCAAACTATTACAAACGACAGG + Intronic
1131711798 15:95063596-95063618 CTCTAAGTATTCCATAAAACTGG + Intergenic
1132053958 15:98635038-98635060 TTCAAACTTTTCAGAAAAAGTGG + Intergenic
1202952820 15_KI270727v1_random:54340-54362 TACAAAAAATACCAAAAAACTGG + Intergenic
1133123662 16:3629620-3629642 TCAAAACTTTTCCAAAAAAGTGG - Intronic
1134510608 16:14843953-14843975 TTCCAACTTCTCCGAAAAACTGG - Intronic
1134698247 16:16242439-16242461 TTCCAACTTCTCCGAAAAACTGG - Intronic
1134973590 16:18552238-18552260 TTCCAACTTCTCCGAAAAACTGG + Intronic
1135064616 16:19298935-19298957 TTGAAACTATTTGAAAAAAATGG + Intronic
1135296867 16:21287309-21287331 CTCAAACTCTACCAAAAAATAGG - Intronic
1136015297 16:27395353-27395375 CTCAAACTCCTCCACAAAACAGG + Intergenic
1136633135 16:31501176-31501198 GTAAAACTATTCAAAAAAGCAGG + Intronic
1136719176 16:32305941-32305963 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136724196 16:32344301-32344323 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136837547 16:33512205-33512227 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136842529 16:33550345-33550367 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136861783 16:33708603-33708625 CTCAAACTATTTTGAAAAACAGG - Intergenic
1137317862 16:47346856-47346878 CTCAGAGTATTCCAGAAAACTGG + Intronic
1137366871 16:47867402-47867424 TGCAAACTATTACACAAAATAGG - Intergenic
1138020504 16:53475510-53475532 CTCAAACTACTACAAAAAGCAGG - Intronic
1138848120 16:60592097-60592119 TTCTAAATATTCCAAAAGAATGG + Intergenic
1139816379 16:69677381-69677403 TTCATATTCTTTCAAAAAACTGG - Intronic
1140950405 16:79811481-79811503 CTCAAAATTTACCAAAAAACCGG + Intergenic
1203002236 16_KI270728v1_random:173464-173486 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203007255 16_KI270728v1_random:211830-211852 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203123279 16_KI270728v1_random:1556787-1556809 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203133839 16_KI270728v1_random:1709870-1709892 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203147730 16_KI270728v1_random:1812483-1812505 CTCAAACTATTTTGAAAAACAGG + Intergenic
1203152694 16_KI270728v1_random:1850642-1850664 CTCAAACTATTTTGAAAAACAGG + Intergenic
1143831788 17:9658098-9658120 TTAAAACAAAACCAAAAAACTGG - Intronic
1144143122 17:12369489-12369511 TTAAAATTCTTCCAAAAATCAGG + Intergenic
1144318750 17:14091976-14091998 TTTAAAAAATTCCATAAAACTGG - Intronic
1145875061 17:28312278-28312300 TTAAAACTTTACTAAAAAACTGG - Intergenic
1146107537 17:30054181-30054203 TAAAAACCATTCCACAAAACAGG - Intronic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1147694968 17:42344920-42344942 TTCAAACTTTTCCAAAGTATAGG - Intronic
1148317012 17:46710069-46710091 TTAAAACTATTCCATACATCAGG + Intronic
1149675133 17:58453136-58453158 CTTAAACTATTCCAAAAAATTGG + Intronic
1151793063 17:76322094-76322116 TTCAAACAATATCAAACAACAGG + Intronic
1153268050 18:3290841-3290863 CTCAAACTATTCTGAAAAATAGG - Intergenic
1153563755 18:6398677-6398699 CTCACACTATTCCAAAACCCAGG + Intronic
1153657479 18:7296619-7296641 AACAAACTTTTCCAAAAAATAGG - Intergenic
1154230827 18:12554588-12554610 CTCAAACTATTCTGAAAAATAGG + Intronic
1154335852 18:13463972-13463994 TTTAATCTAGTCCAAGAAACTGG + Intronic
1154407869 18:14111869-14111891 CTTAAACTATTCCAAAACAGAGG + Intronic
1154445613 18:14433257-14433279 TACAAAAAATACCAAAAAACTGG + Intergenic
1155418125 18:25623391-25623413 ATGAAACTCTTCCAGAAAACTGG - Intergenic
1156285690 18:35693327-35693349 TTCACTCTATTCCAGACAACTGG - Intronic
1156606859 18:38676680-38676702 TTGACACTATTCCAAAAAATAGG - Intergenic
1156791029 18:40975491-40975513 CACAAGCTAATCCAAAAAACTGG - Intergenic
1156846179 18:41667825-41667847 TTCAAAGCATTCCAAATAAATGG + Intergenic
1156896453 18:42252243-42252265 CTAAAAGTATTCCAAAAAATTGG - Intergenic
1157507090 18:48234746-48234768 AATAAACTATTCCCAAAAACTGG - Intronic
1158219155 18:55132275-55132297 TTCAAAATATTCCCAAACAAAGG - Intergenic
1159163913 18:64678655-64678677 TCAAAACTATTTCAAAAAAATGG - Intergenic
1159706785 18:71699865-71699887 TTCAACATCTTCCAGAAAACTGG + Intergenic
1159858893 18:73622555-73622577 CTGAAACGATTCCAAAAAAATGG + Intergenic
1161753099 19:6111431-6111453 TTTAAACTAGTTCAAAATACTGG - Intronic
1162243228 19:9375388-9375410 CTCAAACTCTTCCAAAAAAATGG - Intronic
1162687933 19:12402976-12402998 CTCAAACTATTCCAAAACAGAGG - Intronic
1162794628 19:13080204-13080226 TCCAAACTATTGCAAAAAAAAGG + Intronic
1163739989 19:19005605-19005627 CTCAAACTACTACAAAAAAGGGG + Intronic
1163871251 19:19823091-19823113 TTCAATCTATTCCAATACATTGG + Intergenic
1163955282 19:20632740-20632762 ATCAAACTATTCCAAGCTACAGG - Intronic
1164450128 19:28354734-28354756 CTCAAACTTTTCCAAAACACTGG + Intergenic
1164664071 19:30011634-30011656 AACAAACAATTCCAAAAAAAAGG - Intronic
1166433679 19:42748898-42748920 TTCAAACTACTCCAAGCTACAGG - Intronic
1166585690 19:43946198-43946220 CTGAAACTATTTCAAGAAACAGG - Intergenic
1167272979 19:48516866-48516888 TTCAAAATATTCCCAGAATCTGG + Intergenic
1167407306 19:49320958-49320980 CTCAAACTTTTCCAAAAAATTGG + Intronic
1202692798 1_KI270712v1_random:103508-103530 CTCAAACTATTTTGAAAAACAGG + Intergenic
925247784 2:2399828-2399850 TCTAAACCATTCCAAAAAGCAGG - Intergenic
925542391 2:4979817-4979839 TGCAAACTATTTCCAAAAATGGG - Intergenic
926431813 2:12794791-12794813 TTCAAACATTTACAAAAAATTGG + Intergenic
926852876 2:17220261-17220283 TTAAAACTTTTCCAAAAGACAGG + Intergenic
927630119 2:24765819-24765841 TTCAAACTATTACTTAAAAGGGG - Intronic
928070669 2:28212155-28212177 CTCAAGCTATTCCAACTAACAGG - Intronic
928781681 2:34830075-34830097 TGCAAACTATTCTAAAATAAAGG - Intergenic
928807653 2:35180323-35180345 TTCATACTGTTATAAAAAACTGG + Intergenic
928831085 2:35483622-35483644 TTCAAAATATTTTTAAAAACCGG - Intergenic
928988754 2:37208244-37208266 CTGAAACTATTCCAAAAGATAGG + Intronic
929401351 2:41585544-41585566 TTGAAACTATACCAAAAAATTGG + Intergenic
929845706 2:45523775-45523797 CACAAACTCTTCCAAAAAACAGG + Intronic
929979404 2:46664615-46664637 TGCAAACTATTACAACAGACAGG - Intergenic
930606747 2:53500959-53500981 TTTAAACAGTTCCAAAAAAATGG - Intergenic
930940334 2:57005093-57005115 GTCAAAAAATTACAAAAAACAGG - Intergenic
931534017 2:63251883-63251905 CTGAAACTATTCCAAAAATCAGG + Intronic
931580070 2:63762416-63762438 TTCAGATTATGCCAATAAACTGG + Intronic
933078261 2:77956093-77956115 CACAAACTAGTCCAAAAAATAGG + Intergenic
933120579 2:78531847-78531869 TTCATACTATCCCAAATAAGTGG - Intergenic
933232462 2:79824801-79824823 TTAAAACCATACCAAAAAAAGGG - Intronic
933617830 2:84501571-84501593 CTCAAACTATTCCAAAAACTAGG - Intergenic
933953604 2:87350462-87350484 CTCAAACTATTTTGAAAAACAGG - Intergenic
934111090 2:88743581-88743603 CTGAAACTATTCCAAAAGATGGG - Intronic
934237809 2:90246710-90246732 CTCAAACTATTTTGAAAAACAGG - Intergenic
934275392 2:91570021-91570043 CTCAAACTATTTTGAAAAACAGG + Intergenic
934321941 2:91979259-91979281 CTCAAACTATTTTGAAAAACAGG - Intergenic
934460226 2:94210042-94210064 CTCAAACTATTTTGAAAAACAGG - Intergenic
934996311 2:98964210-98964232 CTGAAACTATTCCAAAAATTGGG - Intergenic
935462267 2:103352204-103352226 TTCAAAATGTTGCAAATAACTGG - Intergenic
935764811 2:106355886-106355908 TTGAAACAATTCCAAGGAACTGG - Intergenic
935851980 2:107232045-107232067 TTCAAATAATTTTAAAAAACAGG - Intergenic
936957542 2:118038068-118038090 TACAAACTATTGCAAAGAGCTGG - Intergenic
938425657 2:131184678-131184700 CTGAAACTATTCCAAAAAGAGGG + Intronic
938572962 2:132578410-132578432 TACAATCTATTCCAGAAAAGAGG - Intronic
939386326 2:141503727-141503749 TTCATACTAATACACAAAACTGG + Intronic
939783790 2:146482926-146482948 ATCAATATATTCAAAAAAACAGG + Intergenic
940678084 2:156749757-156749779 TTCAAACTTTTAAAAAAAAGTGG + Intergenic
941019804 2:160396168-160396190 ATCAAACCATTTCAAAACACAGG - Intronic
941135879 2:161717836-161717858 CTGAAACTATTCCAAACAATTGG - Intronic
941432037 2:165424734-165424756 TCTACTCTATTCCAAAAAACAGG - Intergenic
941546734 2:166860223-166860245 TTCATACTATTGCAACTAACAGG - Intergenic
941600726 2:167540556-167540578 TTCAAATTCTGCCAAAAACCTGG + Intergenic
942253587 2:174068789-174068811 TTCAAACTATAATAAAGAACTGG - Intergenic
942350403 2:175046591-175046613 TTCAAACTATTCCAGAAAATGGG - Intergenic
943557511 2:189423812-189423834 CTCAAACTCTTCCAAAAAATTGG + Intergenic
943897173 2:193379039-193379061 TGCAAATTATTTCAAAAATCTGG - Intergenic
944393277 2:199242132-199242154 CTGAAACTATTCCAATCAACAGG - Intergenic
944456138 2:199896709-199896731 TTAAAACTATCCCATAAAACTGG + Intergenic
944737444 2:202580435-202580457 CTGAAACTGTTCCAAAAAATCGG - Intergenic
945385680 2:209197498-209197520 TTCAAACTTTTCCAAAACATTGG + Intergenic
945490487 2:210448952-210448974 CTGAAACTATTCCAAACAACAGG + Intronic
946883563 2:224200646-224200668 TTGAATCAATTCCAAAAACCAGG - Intergenic
947104769 2:226657760-226657782 TTCAAGCAATTCAAATAAACTGG - Intergenic
947322213 2:228933010-228933032 CTGAAACTATTCCAAACAATAGG - Intronic
947350205 2:229235750-229235772 TTAAAATCATTCCAAGAAACTGG + Intronic
1169980927 20:11383134-11383156 CTAAAACTATTCCAAACAATTGG + Intergenic
1170992537 20:21316390-21316412 ATAAAACTCTTCCGAAAAACAGG - Intronic
1171124882 20:22593153-22593175 TGCACACTATTCCAATAACCTGG - Intergenic
1171362219 20:24595541-24595563 CTGAAACTATTACAAAAAAGTGG - Intronic
1171424389 20:25040520-25040542 ATCAAACTCCTCCAAAGAACAGG + Intronic
1172892192 20:38273436-38273458 TTCAAACAATACCAATATACTGG - Intronic
1173064247 20:39694939-39694961 CTCAAATGATTCCAAGAAACTGG - Intergenic
1173191288 20:40877980-40878002 TTTAAAATATTCCAACAAACTGG + Intergenic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1174416512 20:50370948-50370970 TTCAAATTATAACAAAAAGCTGG + Intergenic
1174918205 20:54675453-54675475 TTTAAACTTTTCCAAATCACTGG + Intergenic
1175014299 20:55772235-55772257 TTCAAACTATTCCAAATCTCAGG + Intergenic
1176450364 21:6856605-6856627 TACAAAAAATACCAAAAAACTGG - Intergenic
1176591351 21:8653080-8653102 CTCAAACTATTTTGAAAAACAGG - Intergenic
1176828533 21:13721623-13721645 TACAAAAAATACCAAAAAACTGG - Intergenic
1177101664 21:16905265-16905287 TTCAATCTGTTTCAAAAAATTGG + Intergenic
1177217767 21:18151552-18151574 TTTAATCAAATCCAAAAAACGGG + Intronic
1177482735 21:21712697-21712719 ATCACACAATTCCAGAAAACTGG + Intergenic
1177541321 21:22497077-22497099 CTAAAACTATTCCAAACAACAGG + Intergenic
1177621887 21:23606311-23606333 CTGAAACTATTCCAAAAAATTGG + Intergenic
1178114676 21:29405056-29405078 TCCAAACTGTTCCAAATGACAGG - Intronic
1178742824 21:35218732-35218754 TTCAAAGTATACAAAAATACTGG + Intronic
1179649094 21:42795046-42795068 TTCAAAATATACAAAAAAATTGG - Intergenic
1180274200 22:10630191-10630213 CTCAAACTATTTTGAAAAACAGG - Intergenic
1180393630 22:12308780-12308802 TTCAAGGCATTGCAAAAAACTGG + Intergenic
1180406119 22:12555972-12555994 TTCAAGGCATTGCAAAAAACTGG - Intergenic
1180548688 22:16525186-16525208 CTCAAACTATTTTGAAAAACAGG - Intergenic
1181271799 22:21663250-21663272 TACAAAATATTCCATCAAACGGG + Intronic
1181356024 22:22296710-22296732 CTCAAACTATTTTGAAAAACAGG + Intergenic
1182380158 22:29881268-29881290 TACAAAAAATACCAAAAAACTGG - Intergenic
1183876959 22:40790839-40790861 ATCAAAGTATTACAAATAACTGG + Intronic
949114578 3:304285-304307 CTGAAACTATTCCAAACAACAGG - Intronic
949203050 3:1403870-1403892 TACAAACTATTCCAAAGCATGGG + Exonic
949967449 3:9369903-9369925 TCCAAACTATTAGAAAACACAGG - Intronic
950236135 3:11321884-11321906 TTCCAGCTATTCCATAAAAATGG + Intronic
950296000 3:11831538-11831560 TTCTACCTATTCTAGAAAACAGG + Intronic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
951339707 3:21469901-21469923 TGCAAAGTATTCCACAAAGCAGG + Intronic
951491782 3:23278939-23278961 ATCAAATTATTAAAAAAAACTGG - Intronic
951654964 3:24996002-24996024 TTCAAACTATTACAAAATATTGG - Intergenic
952836062 3:37603234-37603256 GTGAAAATATTCCAAAAAAATGG + Intronic
953898720 3:46825316-46825338 TACAAACAATTAGAAAAAACTGG - Intergenic
954871726 3:53772465-53772487 ATCAAACCATTCCAGAACACTGG - Intronic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
957166930 3:76686525-76686547 CTCAAACTATTTTTAAAAACTGG - Intronic
957482567 3:80817131-80817153 CTGAACCTATTCCAAAAAAATGG + Intergenic
957721318 3:84003600-84003622 CTGAAACTATTCCAAAAGACAGG - Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
959129072 3:102329701-102329723 TGCAAACTAGCCCATAAAACAGG - Intronic
959306952 3:104679505-104679527 CTCAAACTATTCTGAAAAAGAGG + Intergenic
959384657 3:105687967-105687989 TACAAACTCATTCAAAAAACAGG + Intronic
960276899 3:115738919-115738941 CTAAAACTATTCCAAACAATTGG - Intergenic
962038397 3:131678971-131678993 CTGAAACTATTTCAAAAAATTGG - Intronic
962123413 3:132588327-132588349 TTTAAACTTTGCCAAAAATCAGG + Intronic
963777531 3:149454094-149454116 TTAAAACTATTCCCAAAAAAAGG + Intergenic
964262963 3:154860960-154860982 TTCAAACTTTTCCAATTAAGGGG + Intergenic
964476373 3:157101230-157101252 TTCAAACTATTGCATAAACAAGG + Intergenic
964519528 3:157548718-157548740 CTAAAACTCTTCAAAAAAACTGG - Intronic
964528395 3:157640669-157640691 TTCTAACTATTCTAAATAACAGG + Intronic
964566111 3:158054972-158054994 TCCAAACTGTTCCACAAATCTGG - Intergenic
964803805 3:160584750-160584772 CTCAAACTCTTCAAAAAAAAAGG + Intergenic
965782158 3:172297306-172297328 TTGAAACTATTCCAAATAAAAGG - Intronic
966269323 3:178085566-178085588 TTCAAGCTATTTCAAGAAGCTGG + Intergenic
967203582 3:187098466-187098488 CTGAAACTATTCCAAAAGATAGG + Intergenic
967468477 3:189835612-189835634 TTTAAAATGTTCCAAAAAAGTGG + Intronic
968004555 3:195231934-195231956 CTCAAACTATTCTGAAAAATAGG - Intronic
968580416 4:1388973-1388995 CACAAACTCTTCCAAAAAATAGG - Intergenic
971466845 4:26972784-26972806 CTGAAACTATTCCAATCAACAGG - Intronic
971587930 4:28429329-28429351 CTCAAACTATTTTAAAAAATTGG - Intergenic
971616150 4:28792845-28792867 CTCAGACTATTTCATAAAACAGG + Intergenic
971813435 4:31457684-31457706 TTCATGCTTATCCAAAAAACGGG + Intergenic
971940631 4:33210643-33210665 GTTAAAATATTTCAAAAAACTGG - Intergenic
972755898 4:42045669-42045691 CTGAAACTATTCCAAACAATAGG + Intronic
972961649 4:44460510-44460532 GACAAACCATCCCAAAAAACAGG - Intergenic
973083797 4:46029158-46029180 ATGAAACAATTCCAAAAAAGTGG + Intergenic
973897714 4:55432034-55432056 AACAAACTATTCCAAATCACTGG + Exonic
974093970 4:57341585-57341607 TAAAAACTATTATAAAAAACTGG - Intergenic
974223699 4:59010810-59010832 TTCAAAGCATGCCAAAAAATTGG + Intergenic
974342225 4:60628898-60628920 CTGAAACTATTCCAAACAATAGG - Intergenic
974496650 4:62637625-62637647 TTGAAAATATTCCAAATCACAGG + Intergenic
975297896 4:72754980-72755002 CTGAAACTATTCCAGAAAATTGG + Intergenic
977060435 4:92252572-92252594 TTGAAACTATTCCAAACAATTGG - Intergenic
977634820 4:99285216-99285238 ATCAAACTATAACAAAAAACAGG - Intronic
977874555 4:102132886-102132908 TTCAAGTTGTTCCAAGAAACAGG + Intergenic
978044004 4:104104588-104104610 TTAAAACTATTTTAAAAGACTGG + Intergenic
978085565 4:104648529-104648551 CCCAAACTATTCCAAAAAATAGG + Intergenic
978199592 4:106010052-106010074 TTGACACTATTCCAAAAGATAGG - Intergenic
978357911 4:107896691-107896713 TTCCTACTATTCCAAAAATGAGG - Intronic
978922126 4:114197036-114197058 CTCAAACTATTCTGAAAAATAGG - Intergenic
979658685 4:123226754-123226776 CTGAAACTATTCCAATCAACAGG - Intronic
979984752 4:127299964-127299986 TTGACACTATTCCAAAAGATAGG + Intergenic
980193599 4:129558759-129558781 TATATATTATTCCAAAAAACAGG + Intergenic
980336200 4:131476749-131476771 CTGAAACTATTCCAAACAACAGG + Intergenic
980893522 4:138839339-138839361 ATCATTCTATTCCATAAAACCGG + Intergenic
981131900 4:141166397-141166419 TGGAAACTATTCCAAACAATGGG + Intronic
981285208 4:143009617-143009639 CTCAAACTCTTCCAAAATAATGG - Intergenic
981996392 4:150979919-150979941 CTCAAATTATTCCGAAAAATAGG + Intronic
982593782 4:157351940-157351962 TTCATACTGTTACAAAGAACTGG - Intronic
982816605 4:159893677-159893699 TATTAACCATTCCAAAAAACAGG + Intergenic
982883897 4:160753674-160753696 TTCAATATATTCTGAAAAACCGG - Intergenic
983209872 4:164947443-164947465 TTCAAACTATTGCAAAGTATAGG - Intergenic
984076228 4:175184160-175184182 TTTAAAATATTACACAAAACAGG + Intergenic
984404835 4:179314592-179314614 GTCAAACTATTGGAGAAAACTGG - Intergenic
984792382 4:183626541-183626563 CTTAAAATATTCAAAAAAACAGG - Intergenic
985059295 4:186059823-186059845 GTCAAACCTTTCCAAAAAATGGG - Intergenic
986041759 5:4000550-4000572 TTGAATCTCTTCCAAAAAATAGG + Intergenic
986539965 5:8834629-8834651 TTTAAACTATTCTAACAAGCAGG + Intergenic
986899009 5:12408734-12408756 TTCAAACTGTTCTGAAAAAGAGG - Intergenic
987122544 5:14780590-14780612 TTCAAATTCTTCCACAAAAAAGG + Intronic
987537935 5:19212084-19212106 CTCAAACTATTCTGAAAAACAGG + Intergenic
987631790 5:20482380-20482402 CTCAAACTATTACAAAAAGTAGG + Intronic
987801762 5:22706865-22706887 TTCACACTATTCTGAAAAAGGGG + Intronic
988467614 5:31505655-31505677 TTTAAATTATTACAAAAAAAGGG - Intronic
988545292 5:32151119-32151141 TGCAAACTTTACCAAAAAAATGG - Intronic
989186340 5:38630546-38630568 ATCAAACTACTCCAAACTACAGG - Intergenic
989477756 5:41893583-41893605 TTCAAAGTATTCAAAAAACAAGG + Intergenic
989789204 5:45374596-45374618 CTTAAACTATTCCAAAAACTTGG + Intronic
990664754 5:58059775-58059797 TTCAAAATATTCCCAGAATCTGG - Intergenic
990858762 5:60302212-60302234 CTGAAACTATTCCAAAAAAAAGG - Intronic
990894440 5:60682887-60682909 ATCAAATTATTCCAAAAAAATGG + Intronic
991545914 5:67781203-67781225 ATCAAACTACTCCAAACTACAGG + Intergenic
992465343 5:76998786-76998808 TTGAAACTATTAAAAAAAAAAGG + Intergenic
992588257 5:78264222-78264244 TTCATCCTTTTTCAAAAAACTGG - Intronic
993185226 5:84609332-84609354 TGCAAACTATTCCTAATAACAGG + Intergenic
993205778 5:84876607-84876629 CTCAAACTGTTCCAAAAAATAGG + Intergenic
993392801 5:87342088-87342110 TTCAAACTAATACAAACAGCAGG - Intronic
993813119 5:92508163-92508185 TTGAAAGTATTCCAAAAATTTGG + Intergenic
994015375 5:94958867-94958889 CTAAAACTATTCCAAACAATAGG + Intronic
994057549 5:95435380-95435402 CTCAAATTATTCCAAAAAGCAGG - Intronic
994150503 5:96442148-96442170 ATCAAACTATTCCACATAAGTGG - Intergenic
994382871 5:99092380-99092402 TACAAACTATTGGAAAACACAGG + Intergenic
994529604 5:100952528-100952550 TACAGACTATTTCAAACAACAGG - Intergenic
994707893 5:103228185-103228207 CTAAAACTATTCTGAAAAACTGG + Intergenic
994959591 5:106581727-106581749 TACAAACTATTCCAGAGATCAGG - Intergenic
995121372 5:108539247-108539269 TTCTAACAATTCCAACAAGCAGG - Intergenic
995230672 5:109758096-109758118 GTCAAACTTTTCCAAAAGAGCGG + Intronic
995346343 5:111123441-111123463 TACAAACTCTTTCACAAAACAGG - Intronic
995910191 5:117177533-117177555 TTCAAAGGATTCTAAAAAAATGG - Intergenic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
996274142 5:121644154-121644176 TTGAAACTATTCCAAAAATTTGG + Intergenic
996353953 5:122576545-122576567 TTCAAACTATTTCACAGCACTGG - Intergenic
996627479 5:125587159-125587181 TTCAAACTCCTATAAAAAACTGG + Intergenic
996722371 5:126642492-126642514 TTCAAACCCTTTCAAAAAATAGG - Intergenic
998626611 5:143853248-143853270 ATCAAACTACTCCAAGCAACAGG + Intergenic
998832373 5:146173810-146173832 TGCAAACTATTCAAAAACAAGGG - Intronic
998927102 5:147138511-147138533 CTGAAACTATTCCAAACAATAGG - Intergenic
999350788 5:150869523-150869545 TTGAAACTATTCCAAAAGATAGG - Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
999567127 5:152876820-152876842 TGGAAACTTTTCCAAAAAACTGG + Intergenic
999846570 5:155487875-155487897 TAGAATGTATTCCAAAAAACAGG + Intergenic
1000386745 5:160681672-160681694 TTCAAAATATTCTAGAAATCTGG - Intronic
1000747391 5:165051272-165051294 TTCACACAATTGCCAAAAACTGG - Intergenic
1002013162 5:176301039-176301061 CTCAGACTTTTGCAAAAAACCGG + Intronic
1003394017 6:5737573-5737595 CTCACACTATTCCAGAAAGCAGG - Intronic
1004983747 6:21057066-21057088 CTGAAACTATTCCAAACAACTGG - Intronic
1005208188 6:23429220-23429242 ATGAAACTATTCCAAACAATAGG - Intergenic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1005416637 6:25606747-25606769 CTAAAACTATTCACAAAAACAGG - Intronic
1007014488 6:38450108-38450130 TTCAGACTTATCCAAATAACAGG - Intronic
1008277286 6:49556487-49556509 TTCAAACTATTTCAGAAATATGG + Intronic
1008641708 6:53469869-53469891 CTGAAACTACTCCAAAAAATAGG - Intergenic
1008763913 6:54886327-54886349 TACAAACTCTTCCAGAGAACTGG - Intronic
1008783214 6:55132986-55133008 TTCAAACAATCCTTAAAAACTGG + Intronic
1009649477 6:66456009-66456031 TTTAAACAATTCCAAAAATAAGG - Intergenic
1009800884 6:68534755-68534777 TTCAAACTATTCCGAGAAAGGGG - Intergenic
1010140996 6:72614320-72614342 TTCTAAATACTCCAACAAACAGG + Intergenic
1010151978 6:72743777-72743799 TTAATACTACTCCAAAAAACAGG - Intronic
1010300809 6:74256391-74256413 TTCAAATTATTTCAGAAAAAGGG - Intergenic
1010304106 6:74297710-74297732 TTCAAACTCTTCCAAAAAAGTGG + Intergenic
1010466200 6:76169230-76169252 CTATAACTATTCCAAAACACAGG + Intergenic
1010537526 6:77049376-77049398 TTCAAAATGTTCTGAAAAACTGG - Intergenic
1011252036 6:85381725-85381747 TTCAAACAATTCAAGAAAACTGG + Intergenic
1011361770 6:86533691-86533713 TTCAAAATATTCCAAAAATAAGG - Intergenic
1012060399 6:94471419-94471441 TTCAAACTGTAGAAAAAAACAGG - Intergenic
1012573903 6:100766186-100766208 TCCAAACTATTCCATAAGAATGG - Intronic
1012576991 6:100814486-100814508 TTGAAACCATTCCAAGAAAATGG - Intronic
1012703416 6:102492760-102492782 TTCAAAATATTGGAGAAAACTGG + Intergenic
1012795924 6:103761292-103761314 TTCAAACTCTTCCAAAAGATTGG + Intergenic
1012875246 6:104718882-104718904 TTCAAGTTATTCCATAAAAGAGG - Intergenic
1013964530 6:115938924-115938946 CTGAAACTATTCCAAACAATAGG + Exonic
1014058127 6:117040311-117040333 CTGAAACTATTCCAAACAATAGG - Intergenic
1014520146 6:122432867-122432889 TTAAAACTAGTCCAACTAACTGG - Exonic
1014658503 6:124136453-124136475 CTGAAACTATTCCAAAAGATGGG + Intronic
1014680781 6:124427590-124427612 TCCAAATTATTCAAGAAAACAGG - Intronic
1015900140 6:138056556-138056578 CTAAAACTATTCCAAAAGATAGG + Intergenic
1016133938 6:140514300-140514322 ATCAAACTCTTCCAGAAAATAGG - Intergenic
1016457976 6:144250865-144250887 CTCAAACTATTCAATAACACTGG + Intergenic
1016524349 6:144984741-144984763 TTCAAACTAAAACAAAAAGCTGG - Intergenic
1017396543 6:154006700-154006722 TTCAAAAAAATTCAAAAAACTGG + Intergenic
1020546321 7:9536486-9536508 CTGAAACTATCCCAAAATACTGG - Intergenic
1021305491 7:19026489-19026511 CTAAAACTACACCAAAAAACTGG + Intronic
1021465740 7:20941624-20941646 CTCAAACTTTTCCAAAAAAATGG + Intergenic
1022836447 7:34120692-34120714 TTAAAACTATTCCAAATGGCCGG - Intronic
1023016572 7:35973983-35974005 TACAAGATATTCCAAAAAAAAGG + Intergenic
1024106435 7:46092414-46092436 CTGAAACTATTCCAGAAAATTGG - Intergenic
1024164608 7:46718482-46718504 TTGAAACTAATCAAGAAAACAGG + Intronic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1024722663 7:52155283-52155305 ATCAAATTATTGCCAAAAACAGG + Intergenic
1025547525 7:62195962-62195984 CTGAAACTATTCCAATCAACAGG - Intergenic
1028287884 7:89026524-89026546 TGGAAACTATTCCAAAAATTTGG + Intronic
1028300385 7:89192600-89192622 CTGAAACTATTCCAGAAAATTGG + Intronic
1029658195 7:101941262-101941284 TTCAAACTATGGCAAAAAGTAGG - Intronic
1030953230 7:115818719-115818741 TTAAAAATATTCTAATAAACTGG - Intergenic
1030993034 7:116324432-116324454 TACAGACTATTCCAAAATCCTGG + Intronic
1031338812 7:120572846-120572868 TTCAAACTATTTTATTAAACTGG - Intronic
1032730413 7:134636800-134636822 TTGAAACTATTACTAAAAAGTGG - Intergenic
1032966682 7:137105776-137105798 CTGAAACTATTGCAAACAACAGG + Intergenic
1032967456 7:137116575-137116597 TGCAAACTAGTCCATCAAACTGG + Intergenic
1033525957 7:142213770-142213792 CTGAAACTATTCCAAACAAGAGG + Intronic
1033632577 7:143173771-143173793 TACAAACTCTTCCAAAACAATGG + Intergenic
1033872277 7:145769556-145769578 TTCAAACTATTAAAAAAAACTGG - Intergenic
1035554845 8:559341-559363 CTGAAACTATTCCAAACAATTGG + Intergenic
1035611716 8:970531-970553 TTTACATTAGTCCAAAAAACAGG - Intergenic
1036730879 8:11263398-11263420 CACAAACTTTTCCAAAAAACGGG - Intergenic
1037428071 8:18778997-18779019 CTCAAACTATTCCGAAAAATTGG - Intronic
1037939012 8:22936553-22936575 CTCAAACTCTTCCAAAACATTGG + Intronic
1039289587 8:36079477-36079499 CTGAAACTACTCCAAAAAATTGG + Intergenic
1039678724 8:39704157-39704179 CTGAAACTATTCCATAAAATTGG + Intronic
1039788828 8:40857733-40857755 TTGAAACTTTGCAAAAAAACTGG + Intronic
1040705472 8:50121592-50121614 TTCTAATTATTCTAAAATACTGG - Intronic
1040774646 8:51026694-51026716 TTCAAACTCTTCCAGAAAAGAGG - Intergenic
1041126954 8:54651320-54651342 TCCAAACACTTCCAAAAAAGAGG - Intergenic
1041150598 8:54929028-54929050 TTGACACTATTCCAAAAGATAGG + Intergenic
1041284905 8:56250558-56250580 TTCAATGTATTTCAAAAGACTGG - Intergenic
1041630241 8:60079436-60079458 CTGAAACTATTCCAAACAATAGG - Intergenic
1041823563 8:62066362-62066384 CTCAAACTATTCAGAAAAATAGG + Intergenic
1041922633 8:63199750-63199772 TTTAAGCCATTCCAAGAAACAGG - Intronic
1042038361 8:64563340-64563362 CTGAAACTATTCCAAACAATAGG - Intergenic
1042070480 8:64927985-64928007 CTGAAACTATTCCAAACAATTGG - Intergenic
1042901174 8:73729455-73729477 CTCAAACTCTTCCAAAAAATTGG - Intronic
1043698098 8:83246986-83247008 TTAAAACTATTCTAAAAATAAGG - Intergenic
1044007064 8:86950686-86950708 CTCAAACTATTCTGAAAAACAGG - Intronic
1044877016 8:96679466-96679488 CTCAAACTATTCAAAAAAATTGG - Intronic
1045143744 8:99315937-99315959 TGCAAACAAATTCAAAAAACTGG - Intronic
1045809875 8:106209095-106209117 TTCAAAATATTCCCAAACTCAGG + Intergenic
1046113849 8:109761315-109761337 CTCAGACTATTCTGAAAAACAGG - Intergenic
1046235528 8:111419822-111419844 TGAAAACTATTCCATAAAATTGG - Intergenic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1047447516 8:124932746-124932768 TTTAAACTATTGGCAAAAACAGG + Intergenic
1047538198 8:125738527-125738549 TTCAAGCAATTCCAAGATACAGG + Intergenic
1047788433 8:128177234-128177256 TTCAAACTTATCCGCAAAACCGG - Intergenic
1048619026 8:136111014-136111036 TTCAGACTAGTCAAATAAACTGG + Intergenic
1048794711 8:138138985-138139007 TACCAACTAAGCCAAAAAACAGG - Exonic
1050109960 9:2204548-2204570 GTCAAAGTATACCAAAAAACAGG + Intergenic
1050141236 9:2518135-2518157 CTGAAACTATTCCAAACAATAGG - Intergenic
1050473241 9:6015148-6015170 TTCAATCTACTCCAAAAATGTGG - Exonic
1050517283 9:6458051-6458073 CTGAAACTATTCCAAACAACAGG - Intronic
1050925027 9:11254278-11254300 TCAAAACAATTCCGAAAAACGGG + Intergenic
1051793874 9:20841270-20841292 CTTAAACTATTACAAAAAATAGG - Intronic
1052034844 9:23668903-23668925 TTCAAACTCAACCAAGAAACAGG + Intergenic
1052078065 9:24169120-24169142 TTCAAAATATTCAAGAAGACTGG - Intergenic
1052092817 9:24350302-24350324 TTCAAACCATTCCAGAAAATAGG + Intergenic
1052094319 9:24366120-24366142 CTGAAACTATTTCAAAAAACTGG - Intergenic
1052458088 9:28727200-28727222 CCCAAACTATTCCAAAGAATAGG + Intergenic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1052667681 9:31515920-31515942 CTGAAACTATTCCAAATAATAGG - Intergenic
1052696508 9:31885702-31885724 TTGAAACTATTCCAAATAATAGG - Intergenic
1055194036 9:73564655-73564677 TTTAATTTATTCCAAAAAATGGG - Intergenic
1055279786 9:74661182-74661204 TTAAAAAGAATCCAAAAAACAGG + Intronic
1055367596 9:75561957-75561979 CTGAAACCATTCCAAAAAATTGG - Intergenic
1055723958 9:79207532-79207554 TTCAAACCATTCTGGAAAACAGG - Intergenic
1055911423 9:81356782-81356804 CCCAAACTGTTCCAAAAAATAGG + Intergenic
1055943083 9:81668693-81668715 TTAAAAGTATGCCAAAAAAAAGG + Intronic
1056003200 9:82239543-82239565 CTCAAACTATTCCAAACAAGAGG - Intergenic
1056136882 9:83638737-83638759 TTCAAACTATTGAAAAATAATGG + Intronic
1056643840 9:88392976-88392998 TTCATACTGTTCTAAAACACAGG - Intronic
1056705111 9:88945441-88945463 ATCAAATCATTACAAAAAACAGG - Intergenic
1057563660 9:96149223-96149245 TACAAAATGTTCCAATAAACTGG + Intergenic
1058240702 9:102554422-102554444 TTGAAACTACTCCAAAAACTTGG + Intergenic
1061474716 9:130856940-130856962 TTCAAACCTTTTCAAAAATCTGG + Intronic
1062553284 9:137100299-137100321 TTCAACCTATTCAAAAAATTAGG - Intronic
1203518818 Un_GL000213v1:27912-27934 TACAAAAAATACCAAAAAACTGG + Intergenic
1203621379 Un_KI270749v1:131844-131866 CTCAAACTATTTTGAAAAACAGG - Intergenic
1187049010 X:15677556-15677578 TTCAAACTTGTACAAAAAAATGG - Intergenic
1188393379 X:29649195-29649217 CTCAAGCTATTACAAAAAATTGG + Intronic
1188426734 X:30056600-30056622 ATCAAACTATTTTAAAAAACAGG - Intergenic
1188499503 X:30810088-30810110 TTTATACTAGTCCAAATAACTGG + Intergenic
1188725213 X:33574460-33574482 CTGAAACTATTACAAAAAATTGG - Intergenic
1188880144 X:35482466-35482488 TTCAAATAATACCAAAAAAAGGG + Intergenic
1189447523 X:41094692-41094714 TTCCAAATATTCCAAAATATGGG - Intronic
1189581344 X:42410245-42410267 CTGAAACTATTCCAAAATATTGG - Intergenic
1190553790 X:51613389-51613411 TTCAAAATTTTCAAAAACACTGG + Intergenic
1191767679 X:64716782-64716804 TTCAAACAATTTCAAAAAAATGG + Intergenic
1191900215 X:66032953-66032975 TTCCAAGTATTCCAAAACCCCGG - Intronic
1192089547 X:68139404-68139426 TTCAAAATAATCCAAGAAAGTGG + Intronic
1192133894 X:68578816-68578838 CTGAAACTATTCCAATCAACAGG - Intergenic
1192806025 X:74510033-74510055 CACAAACTCTTCCAAAAAATTGG - Intronic
1192857919 X:75033776-75033798 CTGAAACTATTCCAAACAATAGG - Intergenic
1192880634 X:75279587-75279609 TTGAAATTATTGCAAAAAAATGG - Intronic
1192927720 X:75774114-75774136 TTCAAACTGTTCTGAAAAATAGG + Intergenic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1193215774 X:78862466-78862488 CCCAAACTATTCCAAACAGCAGG + Intergenic
1193252112 X:79303365-79303387 CTAAAACCATTCCAAAAAAGTGG + Intergenic
1193513792 X:82437773-82437795 CTGAAACTATTTCAAAAGACAGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1194084898 X:89514713-89514735 TTCAATGTATTCCACAAAAATGG - Intergenic
1194203862 X:90987095-90987117 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1194357857 X:92909287-92909309 TCCCAATTATTACAAAAAACAGG - Intergenic
1194439083 X:93907157-93907179 CTCAAACTATTCTAAAAAATAGG - Intergenic
1195122462 X:101769323-101769345 ATCAAACTACTGCAAAAAATGGG - Intergenic
1195586432 X:106570385-106570407 CTGAAACTATTCCAAGAAATTGG + Intergenic
1195982997 X:110600419-110600441 CTCAAACTATTCTGAAAAATAGG - Intergenic
1196484830 X:116194156-116194178 TTCAAATTATTCTACAAGACTGG + Intergenic
1196599656 X:117587195-117587217 CTCAAACTAACTCAAAAAACAGG - Intergenic
1196829207 X:119763061-119763083 TTCAAACTTTTCCTATAAAGAGG - Intergenic
1197283877 X:124571846-124571868 TTTAAACTATACCAGAGAACAGG + Intronic
1197366505 X:125570307-125570329 CTGAAACTATTCCAAAAAAATGG + Intergenic
1197402979 X:126015373-126015395 CTCAAACTATTACAAAAATAGGG - Intergenic
1198262609 X:134978838-134978860 TAAAAACTTTTCCAAAAAAAAGG - Intergenic
1198604218 X:138318971-138318993 TTGACACTATTTCAAAAAATAGG - Intergenic
1199146311 X:144372192-144372214 TCCCAATTATTCCAAAAAATAGG - Intergenic
1200437548 Y:3170598-3170620 TTCAATGTATTCCACAAAAATGG - Intergenic
1200549699 Y:4562544-4562566 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1200666038 Y:6024895-6024917 TCCCAATTATTACAAAAAACAGG - Intergenic
1201189423 Y:11434438-11434460 CTCAAACTATTTTGAAAAACAGG - Intergenic
1201467656 Y:14301933-14301955 GTTAAAATATTTCAAAAAACAGG - Intergenic
1201992098 Y:20038386-20038408 TTAAAACTATTTCAAAAAATTGG + Intergenic
1202044159 Y:20720837-20720859 CTGAAACTATTCCAATCAACAGG + Intergenic
1202584215 Y:26407539-26407561 CTCAAACTATTTTGAAAAACAGG + Intergenic
1202600060 Y:26584598-26584620 TTGAAACTATTCCAAAGAACAGG - Intergenic