ID: 1024628581

View in Genome Browser
Species Human (GRCh38)
Location 7:51229496-51229518
Sequence TGCCCTGGAAAACTCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024628581_1024628585 1 Left 1024628581 7:51229496-51229518 CCTTCTTGGAGTTTTCCAGGGCA 0: 1
1: 0
2: 3
3: 23
4: 181
Right 1024628585 7:51229520-51229542 GCAGCCCAGGTGATCCCTTCAGG No data
1024628581_1024628590 22 Left 1024628581 7:51229496-51229518 CCTTCTTGGAGTTTTCCAGGGCA 0: 1
1: 0
2: 3
3: 23
4: 181
Right 1024628590 7:51229541-51229563 GGAGAAAGCCTAATTATTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024628581 Original CRISPR TGCCCTGGAAAACTCCAAGA AGG (reversed) Intronic
901691880 1:10978951-10978973 AGCCCTGGAGAACTCTAAGCAGG + Intronic
905290580 1:36919276-36919298 TGGCCTGGAAGAATCCCAGAAGG + Intronic
905445391 1:38025425-38025447 GGCCCTGGAAAACAGCAAGAAGG + Intergenic
910127758 1:83861871-83861893 TGTCCTGCTAAACTGCAAGAGGG - Intergenic
910768444 1:90806703-90806725 TGCTCTGGCATACTTCAAGATGG + Intergenic
910776386 1:90880541-90880563 TGCTCGGGAAAGCCCCAAGAAGG - Intergenic
911654655 1:100429808-100429830 TGCTTTGTAAATCTCCAAGATGG - Intronic
913322797 1:117600955-117600977 GGCCCAGGAAAACACCATGAAGG - Intergenic
913340095 1:117750183-117750205 TGCACTTATAAACTCCAAGAGGG + Intergenic
913452675 1:119002666-119002688 GCCCCTGGAGAACTTCAAGAAGG + Intergenic
916891772 1:169118837-169118859 TCCCATGGAAACCTCCAGGAAGG - Intronic
918043278 1:180926159-180926181 TGCTCTGGAAAATTCCTAGAAGG - Intronic
918690972 1:187478966-187478988 TGCCCTGCACAGCTTCAAGATGG + Intergenic
920934403 1:210417852-210417874 AGCCCTGGAAAAACCCAAGCGGG - Intronic
921808093 1:219478898-219478920 AGCTCTGGAAAAGTCCCAGAAGG - Intergenic
1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG + Intergenic
1063584048 10:7334889-7334911 TTCCCTGGTAAACTCCTGGATGG - Intronic
1064178580 10:13096566-13096588 GGCCATGCAAAACTCCAGGAGGG + Intronic
1067039483 10:42941462-42941484 TGGCCCGGGAAACTCCAAGCTGG + Intergenic
1067355892 10:45526156-45526178 TTCCATGGAAAGCTCCAAAACGG + Intronic
1067841947 10:49688225-49688247 TGGCCTGAGAAACTGCAAGATGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068708061 10:60099387-60099409 TGCACTGCAAAAGTCCAAGAGGG - Intronic
1069660805 10:70122264-70122286 AGCCCTGGAAGATTCCATGAGGG - Intronic
1072831629 10:98664238-98664260 TACCCTGGTAAACACCCAGATGG + Intronic
1075677135 10:124303529-124303551 CGGCCAGGAAAATTCCAAGAGGG + Intergenic
1075898256 10:126017007-126017029 TGCCATGGAAAACTCAGTGATGG + Exonic
1077460630 11:2707591-2707613 TGCACTGGCACACTCCAAGCAGG + Intronic
1079319380 11:19439063-19439085 GCCCCTAGAAAACTTCAAGATGG - Intronic
1080145382 11:28976855-28976877 TGCCCAGGATAAATACAAGAAGG - Intergenic
1080235281 11:30061207-30061229 TGCCCAGGAAAAACCGAAGAAGG + Intergenic
1081981114 11:47267937-47267959 GGCCCTGGAGAACTCGAAGATGG - Exonic
1082896978 11:58202273-58202295 TGTCATGTAAATCTCCAAGAGGG - Intergenic
1084301776 11:68257067-68257089 TGGCCTGGAACAATCGAAGAGGG + Intergenic
1084891843 11:72240533-72240555 GGCCCTGGAACACTCCAGGAGGG - Intronic
1086111199 11:83200471-83200493 TGCCCTAGAAAACTACAAAATGG - Intronic
1087613208 11:100458502-100458524 AGCCCTGGAGTACTCCAACACGG + Intergenic
1090454348 11:126835061-126835083 TTCACTGGGAAACTCCACGATGG - Intronic
1090495283 11:127205833-127205855 TGTCCTGGGAAACACCAAGATGG + Intergenic
1092729279 12:11513057-11513079 TCCCCTGGAAAACTACTACATGG + Intergenic
1093242223 12:16691259-16691281 TGCAATGGAAAACTTGAAGATGG + Intergenic
1094144214 12:27211914-27211936 TTCTCTGGAAGACTCCATGATGG + Intergenic
1095984151 12:47988585-47988607 TGCCATGGAAACCCCCAGGAGGG + Intronic
1096108407 12:49012957-49012979 TCCCCTGGAAAAATCAAAGCAGG - Intronic
1096685188 12:53283753-53283775 TGCCTTGCAAATCTCCAAAAGGG + Intronic
1098829002 12:75335806-75335828 TGCCTTGGACAACCCCAAGCTGG - Intronic
1099406292 12:82267359-82267381 TACCCTGAAAAATTCCAAGTAGG + Intronic
1099468331 12:83015182-83015204 TGCCATGGAAAACCCCAACATGG - Intronic
1100822477 12:98444331-98444353 TCCCCTAGAAAAGTCCAAGAGGG + Intergenic
1101157930 12:101945115-101945137 TGCCATGGAAGAATCCTAGAAGG + Intronic
1101907445 12:108838289-108838311 TGTTCTGGAAAACACGAAGAGGG - Intronic
1102353947 12:112216623-112216645 TGCACTGGAAATCTCCAGAAAGG + Intronic
1102959967 12:117085998-117086020 AGCCCTGTCATACTCCAAGAAGG + Intronic
1104682704 12:130762335-130762357 TCCCCAGGAAAGCTCCAGGAGGG - Intergenic
1107535342 13:41323933-41323955 TGTCCTGGAAAACTCCAGACAGG - Intronic
1108349337 13:49576556-49576578 TGCACTGGAAAATTCTAAGAAGG - Intronic
1112433840 13:99376390-99376412 CACCCTGGACACCTCCAAGAGGG + Intronic
1112798212 13:103080783-103080805 TACCCTTGAAAACAGCAAGAAGG - Intergenic
1113353383 13:109552490-109552512 GGACCTGGAAAACTCAAAGTAGG + Intergenic
1115392182 14:32866198-32866220 TGTCCTGGGAAACACCCAGACGG - Intergenic
1116176701 14:41479775-41479797 TCCCCAGGACAACTCAAAGAGGG - Intergenic
1120387331 14:83863021-83863043 TTCTCTGGAAAACACCACGAAGG - Intergenic
1124186230 15:27531852-27531874 TGCAGTGGAAAAGTCCAAGTGGG - Intronic
1124707907 15:31980813-31980835 TCCCCTGGAATACTCACAGATGG + Intergenic
1125347411 15:38732252-38732274 TGCCCATGTAATCTCCAAGAAGG + Intergenic
1125390630 15:39189057-39189079 TGCCCAGGAAAACAGGAAGAAGG - Intergenic
1125827462 15:42688582-42688604 TGCCCTTGAATTCTCCAAGGTGG + Exonic
1127309960 15:57743809-57743831 TGCCCTGGAATTCTCCAGCAGGG + Intronic
1127574134 15:60273511-60273533 TGCCCTGGAAAATTCACACATGG + Intergenic
1127625139 15:60772955-60772977 AGCCCTGGAAAACTCCCTGGCGG - Intronic
1131074990 15:89489913-89489935 TACGCTATAAAACTCCAAGAAGG + Intronic
1132535182 16:475542-475564 TGCCCTGGAAAACTCCATGTAGG + Intronic
1132731174 16:1362721-1362743 GACCCTGGAAAACTGCAGGAAGG + Exonic
1136461579 16:30414304-30414326 GTCCCTGGCACACTCCAAGAGGG - Intronic
1140851957 16:78943423-78943445 AGACCTGGAGAACTCCTAGAGGG + Intronic
1141583521 16:85017425-85017447 TGCCCTGGACAACTCACAGGAGG + Intergenic
1142319242 16:89370421-89370443 TGCCCTGGATAACGGCAGGAGGG - Intronic
1142386727 16:89770065-89770087 TGCCCTGGAAAATTCCAGCTTGG - Intronic
1143156192 17:4838141-4838163 TCCCCTGGAAAATTGCAAAAGGG + Intronic
1143256563 17:5562065-5562087 TGCCCAGGGAAACACCCAGATGG + Intronic
1144388155 17:14769353-14769375 TTCCCTGGTAATCCCCAAGAAGG + Intergenic
1147181709 17:38690693-38690715 TACCCTGGAACACTCACAGAAGG - Intergenic
1148834894 17:50460881-50460903 TGACCTGGAAACCTCAAAGTGGG + Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151335290 17:73436098-73436120 TGCTCTGGGAACCTCCAAGTGGG + Intronic
1151464656 17:74276695-74276717 GGCCTTGGGAAACACCAAGAAGG + Intronic
1154041936 18:10864706-10864728 TGCCCTGGCAAAGCCCCAGAAGG + Intronic
1154232467 18:12569756-12569778 GGCCCTGGAAATGTCCAAGGGGG - Intronic
1155428706 18:25733100-25733122 TGTTTTGGTAAACTCCAAGAGGG + Intergenic
1156488343 18:37481000-37481022 TTTCCTGGTAAACTCAAAGAAGG + Intronic
1156524477 18:37753808-37753830 TGCACTGTGAATCTCCAAGAAGG + Intergenic
1157399588 18:47376443-47376465 TGCCCTGCACAACTCCCCGACGG + Intergenic
1158260310 18:55599268-55599290 TGCACAGGGAAACTGCAAGAGGG - Intronic
1158442503 18:57489328-57489350 TGATCTGGAAAAATACAAGAGGG + Exonic
1158883422 18:61803249-61803271 GGCCCTGGAAATCTCTAAAATGG - Intergenic
1158942175 18:62414865-62414887 TGTCCTGTATAACTCTAAGATGG - Intergenic
1160012068 18:75113648-75113670 TGACCTGCACACCTCCAAGACGG + Intergenic
1161029644 19:2051667-2051689 AGCACTGGAGAACTGCAAGAGGG - Intergenic
1164426623 19:28147539-28147561 TGCCCCTGAACACTCCAAGTCGG - Intergenic
1168210113 19:54884100-54884122 TTCCCTGGAAAGCACCCAGATGG - Intronic
925822473 2:7813782-7813804 CACCCTTGAAAACTCCAAGCTGG + Intergenic
926113686 2:10197787-10197809 GGCCCTGGGAAACCCTAAGATGG - Intronic
929119841 2:38475723-38475745 TGGCCTGGTAAAGTCAAAGAAGG - Intergenic
930678890 2:54234172-54234194 TGCCCAGGAAAGCTTCAACAGGG - Intronic
931601933 2:64012931-64012953 TGCCCTGAAAAAGTCAAAGAAGG + Intronic
933945112 2:87279389-87279411 TGCCCTGGATCACACCAAGTGGG + Intergenic
936650480 2:114420920-114420942 TGCCCTGGAGAAGCCCAAAAGGG - Intergenic
938422926 2:131158197-131158219 TCCCCGGGGAAGCTCCAAGAAGG + Intronic
940245933 2:151616073-151616095 TGCTTTGGAAGAGTCCAAGAAGG - Exonic
942665157 2:178309792-178309814 TGCCCTAAAACATTCCAAGAGGG + Intronic
942699380 2:178687037-178687059 TGCCTTGGAATAGGCCAAGATGG - Intronic
946690395 2:222304898-222304920 CGCCCCGGAAAACTCTATGAGGG + Exonic
948671906 2:239574340-239574362 TGCCCTGGGAAGCTCTTAGAAGG + Intergenic
1168743315 20:213565-213587 TTCAGTGGAAAACTCCATGAGGG + Intergenic
1169204284 20:3731553-3731575 TGCCTTTGAAAGCTCCACGAGGG + Intergenic
1169217395 20:3801608-3801630 TTCCCTGGCAAACTCCAGGTTGG - Intronic
1169457808 20:5767811-5767833 AGCTCTGGAAACCTCCAAGGTGG - Intronic
1170600693 20:17839155-17839177 TGCCCTGGCAACCACGAAGATGG + Intergenic
1170824989 20:19786028-19786050 TGCACTGGAAATCTCACAGAGGG - Intergenic
1170941654 20:20853285-20853307 TGCCCTAGTAGACTCCATGAGGG + Intergenic
1170959347 20:21011284-21011306 TACACTGGAAAAGTCCATGAGGG + Intergenic
1173456699 20:43208316-43208338 TGCTCTGGCAAACTCCCTGAAGG - Intergenic
1175533329 20:59689697-59689719 TCCCCTGGAACTCTACAAGAGGG - Intronic
1178633836 21:34285188-34285210 TCCTCTGGAAAACTCCAGTATGG - Intergenic
1179227424 21:39467044-39467066 TTCCCTGGAAAAGTACTAGAAGG - Intronic
1184090901 22:42292597-42292619 TGGCCTGGATAAATCCCAGAAGG + Intronic
949594856 3:5532673-5532695 TGCCCTGGGAAATACCCAGATGG - Intergenic
949607711 3:5672528-5672550 TGACCTGGAAAAGGCCCAGAAGG - Intergenic
950020527 3:9784265-9784287 AGCCCTGGGAACCTCCAAGGTGG - Intronic
950047953 3:9962020-9962042 TGCCCTGGAAAGGTCCAGGTTGG - Intergenic
951984760 3:28606472-28606494 TGTCCCGGCAAACTCCAGGATGG + Intergenic
955816849 3:62852755-62852777 TGGCCTGTAAAACTCCTGGAGGG - Intronic
955881461 3:63550923-63550945 TGGCCTGGAAAACTGGAAGATGG - Intronic
959206086 3:103308843-103308865 TGCCCTGGAAAAATTCTAGAGGG - Intergenic
961930691 3:130529789-130529811 GGCCCTGGAAAAGTTCATGAGGG + Intergenic
962453360 3:135540582-135540604 TGCCCTGGAAACCAGCCAGAAGG - Intergenic
970225829 4:13855796-13855818 TGCACTTCAAAACTCCAAAATGG - Intergenic
970508367 4:16755811-16755833 CGCCCTGGACAACACCAGGAAGG - Intronic
970605777 4:17680871-17680893 CGCCCAGGAAATCTCCTAGAAGG + Intronic
972177675 4:36427839-36427861 TGTCCTGGAAAACACCCAGATGG + Intergenic
973750652 4:54017348-54017370 TGGCCTGGAATACTGAAAGATGG - Intronic
974272466 4:59668732-59668754 TTCCCTGGAAATGTCTAAGATGG + Intergenic
975582828 4:75922066-75922088 TGCCCTGGCAATATCCAGGATGG - Intronic
977394575 4:96454781-96454803 TGCCCTGAGAAACACCCAGAAGG - Intergenic
981279110 4:142936594-142936616 TGCCCTGGAACACCCCACTAAGG + Intergenic
982973962 4:162028763-162028785 TGTCCTGTAAAACTGAAAGATGG - Intronic
983869592 4:172809641-172809663 TCCCCTGGAAAACTTGTAGAAGG - Intronic
985183303 4:187289142-187289164 TGGCCTGGAAGACTTCAACAGGG - Intergenic
985853160 5:2403579-2403601 TACACAGGAATACTCCAAGAAGG - Intergenic
986897181 5:12384859-12384881 TGCCCTGGAAAACACCTAGATGG - Intergenic
987062057 5:14252354-14252376 TACCCTGAAAATCACCAAGAAGG - Intronic
990924867 5:61009316-61009338 TGCACTGGAATTCTCCAAGAGGG + Intronic
991245755 5:64506768-64506790 AGCCCTGGACGACTGCAAGATGG + Exonic
991613485 5:68472058-68472080 TGCCTTTGAAACCTCCAAAATGG - Intergenic
992624707 5:78626562-78626584 TGCCCTCAGAAACTCCCAGAAGG - Intronic
995654926 5:114414984-114415006 TCACCTGGAAGACTGCAAGAGGG - Intronic
995847353 5:116508549-116508571 TGCCCTGGAAAATTCTACGGGGG + Intronic
996977268 5:129449931-129449953 TGCAATGGAAAAGTCCAAGCAGG + Intergenic
998545034 5:143020246-143020268 TGCCCTTAAGAACTCCCAGAAGG - Intronic
1000114646 5:158142421-158142443 GGCCCTGGACCACTCCCAGAAGG - Intergenic
1001234842 5:170020884-170020906 TGCACTGGGAATCTCTAAGATGG - Intronic
1002468712 5:179421969-179421991 AGCCCTGGAGAAGTCCAACAAGG + Intergenic
1003708425 6:8561434-8561456 TGCCCTGGGAAACTGTAAGATGG - Intergenic
1006084988 6:31589151-31589173 TGACCTGGAAAGGTCCAAGAAGG - Exonic
1012045780 6:94271337-94271359 TGGACTGGAAAACTCCAAGTTGG + Intergenic
1015833970 6:137399307-137399329 TGACCTGGAAAAGGCCATGATGG - Intergenic
1016469611 6:144361458-144361480 TTCCCTGGAAGACTCCTGGATGG - Intronic
1018060805 6:160088204-160088226 TGCCCATGAAAACCCCAAGGAGG - Intronic
1018912252 6:168108540-168108562 TCCCCTGGAACACTCAAGGAAGG - Intergenic
1019698162 7:2459549-2459571 TGGCCTGGAAACCTCCAAGGAGG + Intergenic
1021862483 7:24920648-24920670 ATCCCTTGAAAACTCCAACAAGG + Intronic
1022961271 7:35429150-35429172 GGCCCTGGCCAAATCCAAGATGG - Intergenic
1024595178 7:50926990-50927012 TACCATGGAAAATCCCAAGATGG - Intergenic
1024628581 7:51229496-51229518 TGCCCTGGAAAACTCCAAGAAGG - Intronic
1025534867 7:61935139-61935161 TCCCCTGAAAAAGACCAAGAAGG + Intergenic
1026793028 7:73346985-73347007 TGACTGGGAAAACTCCATGAGGG + Intronic
1031692023 7:124800504-124800526 AGCCCTGTAAGACTGCAAGAGGG - Intergenic
1032582708 7:133117976-133117998 TGTCCCAGAAAACTCCAAGATGG - Intergenic
1034343213 7:150370990-150371012 TGCCCTGGAAACTTCCAGAAGGG - Intronic
1040416490 8:47200508-47200530 TGCCCTGGAAGAATCCTGGAAGG - Intergenic
1040536397 8:48314877-48314899 TGCCGTGTAAACCTCCTAGAAGG + Intergenic
1040733635 8:50479777-50479799 TGTCTTGGAAAACTTCAACAGGG - Intronic
1041867518 8:62594111-62594133 AGTCCTGCAAAACTCCAAGCAGG - Intronic
1042969790 8:74395661-74395683 TGCTGTGGAAAACTCTAACATGG + Intronic
1044906537 8:97009999-97010021 TGCACTGGAAAACTTGAAGAGGG + Intronic
1048870895 8:138796854-138796876 TGCCCTAGAAAAATGAAAGAAGG + Exonic
1048973670 8:139658971-139658993 AGCCCAGGAAAGCTCCCAGAAGG + Intronic
1050106739 9:2173704-2173726 TGTACTGGGAATCTCCAAGAAGG - Intronic
1050368089 9:4891073-4891095 TGCACTGTAAGTCTCCAAGATGG - Intergenic
1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG + Intronic
1055981297 9:82004767-82004789 TGGCCTGAGAAACTCAAAGAAGG - Intergenic
1056063909 9:82913768-82913790 TTCCCTGCTAAACTCCAAGTAGG - Intergenic
1056398768 9:86206540-86206562 TGCTCTGGAAAATTCCTGGATGG + Intergenic
1057300413 9:93875997-93876019 TGCCCTGCAAAAGTACAAAAAGG + Intergenic
1057469524 9:95345010-95345032 GCCCCTGGATAACTACAAGATGG - Intergenic
1057814838 9:98286813-98286835 TGTCCCGGAAAACTCCAGGCTGG + Intergenic
1058313290 9:103533240-103533262 TGCCCCAGAAAACACCCAGATGG + Intergenic
1058845043 9:108949155-108949177 TGCCCAGGAAAACTGCTACAAGG + Intronic
1060000744 9:119956567-119956589 TTGCCTGGAAAAGGCCAAGAAGG - Intergenic
1185456613 X:313977-313999 AGCCCTGGAAGATTCCAACAGGG - Intronic
1185456633 X:314057-314079 AGCCCTGGAAGATTCCAACAGGG - Intronic
1188410344 X:29864326-29864348 TGCTTTGGAAATCTCCAAGAAGG + Intronic
1188440073 X:30207991-30208013 TGCACTGGAAAACTCCAAAAGGG - Intergenic
1188907029 X:35801702-35801724 AGCCCTGGTAAACTCCAGGTTGG + Intronic
1191866037 X:65704617-65704639 TTCCGTGAAAAACTCCAAGCTGG - Intronic
1193439830 X:81526159-81526181 TCCCCTGGAAAACTGAAACAAGG - Intergenic
1200087925 X:153619101-153619123 TGCCCCGGAAAACTGTCAGAAGG - Intergenic
1201631610 Y:16076568-16076590 TGCACTGCAAAACCCCAAGGAGG + Intergenic