ID: 1024629977

View in Genome Browser
Species Human (GRCh38)
Location 7:51238860-51238882
Sequence TTCCCGGGAGTCCCCGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024629965_1024629977 26 Left 1024629965 7:51238811-51238833 CCCTGGCAACCCTGCCTCATCCC 0: 1
1: 0
2: 2
3: 38
4: 404
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629969_1024629977 12 Left 1024629969 7:51238825-51238847 CCTCATCCCTAAATATACCAGTC 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629971_1024629977 6 Left 1024629971 7:51238831-51238853 CCCTAAATATACCAGTCAGGAAA 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629972_1024629977 5 Left 1024629972 7:51238832-51238854 CCTAAATATACCAGTCAGGAAAT 0: 1
1: 0
2: 1
3: 29
4: 320
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629966_1024629977 25 Left 1024629966 7:51238812-51238834 CCTGGCAACCCTGCCTCATCCCT 0: 1
1: 0
2: 3
3: 30
4: 446
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629973_1024629977 -5 Left 1024629973 7:51238842-51238864 CCAGTCAGGAAATTCTTCTTCCC 0: 1
1: 0
2: 3
3: 15
4: 253
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629967_1024629977 17 Left 1024629967 7:51238820-51238842 CCCTGCCTCATCCCTAAATATAC 0: 1
1: 0
2: 1
3: 12
4: 188
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92
1024629968_1024629977 16 Left 1024629968 7:51238821-51238843 CCTGCCTCATCCCTAAATATACC 0: 1
1: 0
2: 1
3: 6
4: 143
Right 1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG 0: 1
1: 0
2: 1
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024629977 Original CRISPR TTCCCGGGAGTCCCCGGTGA AGG Intronic
900129925 1:1083055-1083077 CTCCCGAGAGCCTCCGGTGAGGG - Intronic
901492512 1:9603633-9603655 ATCCCGGCAGACCCAGGTGACGG - Intronic
910226846 1:84944574-84944596 TTGGCGGGATTCCCCAGTGATGG - Intronic
915689153 1:157670211-157670233 TTTCAGGGAGTCCACGCTGATGG + Intergenic
921335007 1:214076952-214076974 TTCCCCAGAGTCTCCCGTGAAGG + Intergenic
1064022758 10:11823193-11823215 CTCCCGGGGGTCCTCGGTCAAGG - Intergenic
1065003451 10:21358252-21358274 TACCTGGGAGTCCCAGCTGAGGG - Intergenic
1065658733 10:27982678-27982700 CTCCAGGCAGTCCCCCGTGATGG + Intronic
1073547713 10:104365849-104365871 TTCCCGGGAGTTCCGGAAGAAGG + Exonic
1076273736 10:129178652-129178674 TGGCCGGGAGTCTCAGGTGAAGG + Intergenic
1078105977 11:8358202-8358224 TTCCCTGGTGTCCCAGGAGAGGG - Intergenic
1095961128 12:47834930-47834952 TACCCAGGAGCCCCCGGAGAGGG - Intergenic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1102755620 12:115337710-115337732 TTCCCGGGTGGCCCTGATGATGG + Intergenic
1103927194 12:124429555-124429577 TTCCCTGGCATCCCCCGTGAGGG - Intronic
1104546331 12:129716268-129716290 TGCAAGGGAGTCCCCGATGATGG + Intronic
1104984325 12:132587988-132588010 TTCCTGGGAGTACTCTGTGAGGG + Intergenic
1105291434 13:19056075-19056097 TGCCCGGGAGTCCCTGGTGTTGG - Intergenic
1105977523 13:25485619-25485641 TTCCTGTGAGTCCCAGATGATGG + Intronic
1118436569 14:65776629-65776651 TTCCCGGGGATCCCCTATGAAGG + Intergenic
1119998732 14:79279708-79279730 TTCCTGGGAGTCTCCGCGGAAGG - Intronic
1121874902 14:97442192-97442214 TTCTCTGCAGTCACCGGTGATGG - Intergenic
1122776245 14:104118151-104118173 TTCCAGGGAGGCTCCGGCGAAGG - Intergenic
1124425262 15:29557819-29557841 TTCCTGAGAGTTCCCAGTGAGGG - Intronic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1128457677 15:67841429-67841451 TTCCCGGGAGACCACTGTGGTGG + Intergenic
1132164008 15:99566578-99566600 TTCTCGGGAGACCCCGGAGAAGG + Intronic
1136242763 16:28954609-28954631 TTCCAGGGAGAGCCTGGTGATGG - Exonic
1136923012 16:34346775-34346797 TTCCTGAGAGTCACTGGTGATGG + Intergenic
1136981561 16:35065031-35065053 TTCCTGAGAGTCACTGGTGATGG - Intergenic
1139443111 16:66979032-66979054 TTCCCTGAAGTCCCCAGGGAGGG - Intergenic
1139652835 16:68371269-68371291 CTCCCGGGAGTCCCTGGTGAAGG - Exonic
1140903909 16:79394416-79394438 TTCCTGGGAGGCCCAGGGGAGGG - Intergenic
1141861356 16:86718589-86718611 TTCCCTGCAGACCCCGGGGATGG + Intergenic
1142959813 17:3545413-3545435 CTCCCGGGAGCCCTCGGAGATGG + Intronic
1143361176 17:6372518-6372540 TGCCCAGGAGTCCCTGCTGAAGG - Intergenic
1143543379 17:7582573-7582595 TTCCCAGGAGCCCCCAGTGGAGG - Intergenic
1145236196 17:21209998-21210020 TTCCCGGGTGTGCTCGGTCATGG + Intronic
1150380052 17:64713251-64713273 TTCCCGGGAGGCCCAGGAAAGGG - Intergenic
1150776674 17:68086910-68086932 TTCCCGGGAGGCCCAGGAAAGGG + Intergenic
1152517883 17:80836824-80836846 TTCCTGGGATTCCCAGGTGTAGG - Intronic
1152809156 17:82373037-82373059 TTTCAGGAAGTCCCCGGTCACGG + Intergenic
1160226645 18:77017101-77017123 TTCCCGAGATGCCCCGGGGAGGG - Exonic
1161176046 19:2842412-2842434 CTCCCGGGCGTCCCCGCTGTGGG - Intronic
1161486204 19:4537144-4537166 TTCCCAGGACTCCAGGGTGAAGG - Exonic
1163005510 19:14394656-14394678 ATCCTGGCAGTCCCCGGCGATGG - Intronic
1163324001 19:16591621-16591643 TTCACTGGAGACCCAGGTGAAGG + Intronic
1164761309 19:30730341-30730363 ATCCTAGGAGTGCCCGGTGAAGG + Intergenic
1165717336 19:38054916-38054938 TTCCCGGGAGCCCCTGCTGCTGG + Intronic
927848470 2:26484402-26484424 CCCCAGGGAGCCCCCGGTGAGGG - Intronic
935146614 2:100399774-100399796 TTCCTGGGATTCCCTGGTGGTGG + Intronic
948288234 2:236803831-236803853 TGCCCGGGAATCCCCATTGACGG - Intergenic
948430154 2:237913617-237913639 TTCCTGAGAGGCCCCAGTGAGGG + Intergenic
949032619 2:241804218-241804240 ATCCCCGGCCTCCCCGGTGACGG - Intergenic
1171223540 20:23421578-23421600 TTCCCAGGAGGCCCCGGGGCGGG + Intergenic
1173750307 20:45470624-45470646 TTCCCGGGGGTCCCCGGGTCCGG - Intronic
1175246881 20:57587550-57587572 TTCCCAGGAGTCCCTGCTCAAGG - Intergenic
1175310037 20:58005480-58005502 TTCCCTTGAGTCCCCTGTGTTGG - Intergenic
1175884760 20:62283384-62283406 TTCCCGGGAGTCTGTGGTCACGG + Intronic
1175998103 20:62820299-62820321 TGCCCGGGGGTCCCTGGTGGTGG - Intronic
1176051938 20:63124590-63124612 TTCCCGGGAGCCACCGCTGCAGG + Intergenic
1176081656 20:63276429-63276451 TCCCTGGGTGTCCCCGGTGCTGG + Intronic
1178621156 21:34177642-34177664 TTGCAGGGAGTCCAGGGTGAGGG + Intergenic
1178932894 21:36835022-36835044 TTCTCGAGATTCCCAGGTGAGGG + Intronic
1180945714 22:19692058-19692080 TTCCCGGGAGCCCCCGCCCAAGG + Intergenic
1181860069 22:25811403-25811425 TTCCCAGCAGCCCCCAGTGAGGG + Intronic
1183432240 22:37772814-37772836 GTCCAGGGAGTCCCGGGTGTGGG - Intronic
949491525 3:4594164-4594186 TACCAGTGAGTCCCTGGTGAAGG - Intronic
967142206 3:186570708-186570730 TTCCCGGGAGTCCCGAGTCCCGG - Exonic
967158147 3:186712130-186712152 CTCCCTGGAGTCCCTGGAGAAGG - Intergenic
968972308 4:3802417-3802439 GTCCCAGGAGCCCCAGGTGAAGG + Intergenic
985898648 5:2767289-2767311 TTCCCTGGAAACCCCGGTGAAGG + Intergenic
994768580 5:103953855-103953877 TGCCCGGGAGCCCACGGGGAAGG + Intergenic
994911659 5:105917236-105917258 TTCCAGGGAGTTGCAGGTGAAGG - Intergenic
998334364 5:141357473-141357495 CTTCCGCGAGTCCGCGGTGAGGG - Exonic
998337430 5:141385172-141385194 CTTCCGAGAGTCCGCGGTGAGGG - Exonic
999230297 5:150057748-150057770 TGCTCGGCTGTCCCCGGTGAGGG + Intronic
1011488421 6:87867025-87867047 TTGGTGGGAGTCCCCGGTGGAGG + Intergenic
1012411230 6:98959787-98959809 TTCTGGGGAGTCCCTGGTGCTGG - Intergenic
1012928949 6:105296951-105296973 TTCCTGGAAGTCACCTGTGAGGG + Intronic
1013059135 6:106614962-106614984 TTCCAGGGAGTCCTGGGTGGGGG - Intronic
1015620436 6:135126560-135126582 TCCTCGGGTGTCCCAGGTGATGG - Intergenic
1017622032 6:156309081-156309103 TTCCTGCCAGGCCCCGGTGATGG - Intergenic
1023440772 7:40182877-40182899 TTCCCTTGATTCCACGGTGAGGG - Intronic
1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG + Intronic
1025078752 7:55964718-55964740 TTCCCGGGAGGTGCCGGGGAGGG + Intronic
1026963492 7:74424653-74424675 TCCCCGGGAGTTCCCTGTGTGGG - Intergenic
1029945551 7:104529099-104529121 TTCCCGAGAGGCCCAGGAGATGG + Intronic
1035312287 7:157977201-157977223 CACCAGGGAGTCCCCGGTGCTGG - Intronic
1037817367 8:22119254-22119276 TCCCCAGGTGTCCCCGGTGCGGG + Exonic
1039630571 8:39107643-39107665 TTCTCCGGAGGCCCCGGAGACGG - Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049455080 8:142682597-142682619 TTCCTGGGAGTCTCCAGAGATGG + Exonic
1051591178 9:18777672-18777694 TCCCCCGGCGTCCCCGGTGGAGG - Exonic
1060780734 9:126410594-126410616 TTCCAGGGAGGCCCGCGTGAAGG - Intronic
1061346244 9:130028011-130028033 TTTCCGGGAGGCCCAGGTGGGGG - Intronic
1187396963 X:18927295-18927317 TCCCGGGTTGTCCCCGGTGATGG - Intronic