ID: 1024630432

View in Genome Browser
Species Human (GRCh38)
Location 7:51242843-51242865
Sequence CTGTGCGGAGGTGATAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024630432_1024630438 10 Left 1024630432 7:51242843-51242865 CCAACATTATCACCTCCGCACAG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1024630438 7:51242876-51242898 CAACAAGGTACCTGACACCGAGG No data
1024630432_1024630436 -5 Left 1024630432 7:51242843-51242865 CCAACATTATCACCTCCGCACAG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1024630436 7:51242861-51242883 CACAGCTGGTTCATCCAACAAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1024630432_1024630441 21 Left 1024630432 7:51242843-51242865 CCAACATTATCACCTCCGCACAG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1024630441 7:51242887-51242909 CTGACACCGAGGAAAGCCCAGGG 0: 1
1: 0
2: 2
3: 12
4: 197
1024630432_1024630440 20 Left 1024630432 7:51242843-51242865 CCAACATTATCACCTCCGCACAG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1024630440 7:51242886-51242908 CCTGACACCGAGGAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024630432 Original CRISPR CTGTGCGGAGGTGATAATGT TGG (reversed) Intronic
907823469 1:57992958-57992980 CTGTGCGGAGTTGGTGATGAAGG - Intronic
907860926 1:58352249-58352271 CTGTGCTGAGGACATAATGTAGG + Intronic
907971536 1:59387125-59387147 CTGTCAGGAGATGATTATGTTGG + Intronic
915468106 1:156109503-156109525 CTGTGCAGAGGTGCTGAAGTGGG - Intronic
1063039288 10:2320292-2320314 CTGAGCAGAGGTGAGAATGAAGG - Intergenic
1063905588 10:10777226-10777248 CTGGATGGAGGTGACAATGTGGG - Intergenic
1065282007 10:24148994-24149016 CTGTGTTGAGGTGAGAATCTTGG + Intronic
1065782362 10:29181844-29181866 CTGTCCGGAAGTGCCAATGTAGG + Intergenic
1069778965 10:70943040-70943062 ATGTGCTGAGGGGATAGTGTGGG + Intergenic
1071895533 10:90062449-90062471 CTGTGGTGAGGTGATGATGGTGG - Intergenic
1072771204 10:98140036-98140058 CTGTGCAGAGTGAATAATGTGGG + Intronic
1083713826 11:64564570-64564592 CTGTGTGGAGGTGGTGATGGAGG - Intronic
1090048964 11:123360573-123360595 CTGTGCTTTGGTGATAGTGTTGG + Intergenic
1090316225 11:125791336-125791358 CAATGGGGAGGTGATAATGGAGG - Exonic
1098444436 12:70551713-70551735 CTCTGCAGAAGTAATAATGTTGG + Intronic
1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG + Intronic
1100160632 12:91856467-91856489 CTCTGAGGAGGTTATAATGTCGG + Intergenic
1110961754 13:81635179-81635201 GTGTGCAGAGATGATAATTTGGG + Intergenic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1121413350 14:93762657-93762679 CTGTGCTGAGATGAGACTGTGGG - Intronic
1137007823 16:35294869-35294891 ATGTGCAGTGGGGATAATGTGGG - Intergenic
1144761708 17:17710928-17710950 CTGTGCGGGGGTGTTGATGGGGG + Intronic
1146866355 17:36338161-36338183 CTGTGCTGTGGGGATAACGTAGG + Intronic
1147069225 17:37938773-37938795 CTGTGCTGTGGGGATAACGTAGG + Intergenic
1147080753 17:38018310-38018332 CTGTGCTGTGGGGATAACGTAGG + Intronic
1147096696 17:38142270-38142292 CTGTGCTGTGGGGATAACGTAGG + Intergenic
1149252452 17:54785862-54785884 CTGTCCCCAAGTGATAATGTGGG + Intergenic
1149292157 17:55227713-55227735 CAGTGCAGAGGTGAGAATGCAGG - Intergenic
1156136679 18:34048568-34048590 CTGTGCAGAGGAGAGAATTTAGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164945759 19:32291877-32291899 CTGTGCAGAGATGAAAAGGTGGG - Intergenic
930155832 2:48106845-48106867 CTGTGCGGAGTTGGCAACGTGGG - Intergenic
931359160 2:61563632-61563654 CTCTGCAGAGGTGCTAATCTGGG - Intergenic
942153899 2:173107199-173107221 CTGTCTGGAGGTGGTAATGAGGG + Intronic
942328356 2:174794721-174794743 CTGTGAGAAGGTGATGACGTGGG - Intergenic
946052448 2:216875102-216875124 CAGTGATGAGATGATAATGTTGG + Intergenic
1170538934 20:17369055-17369077 CTGTGTGGAGGTGTGAAGGTGGG - Intronic
1178472431 21:32905329-32905351 CTGATCAGAGGTGATAATATAGG + Intergenic
949141581 3:640112-640134 CACTGCTGAGGTAATAATGTGGG - Intergenic
949278043 3:2310521-2310543 ATGTGCTGAGGTGAAAAAGTGGG - Intronic
952766353 3:36957310-36957332 CTTTGTGGAGGTGATAATGAAGG - Intergenic
954292916 3:49659167-49659189 GTTTGTGGAGGTGATAATCTTGG + Intronic
954301347 3:49702288-49702310 CTGTGCTGAGCTGAGAATGCAGG - Intronic
956544512 3:70385528-70385550 CTGTGTGGGGGTGACAATGGGGG + Intergenic
964298569 3:155261882-155261904 CTGTGCTGAGATGATATTTTAGG + Intergenic
969103643 4:4788833-4788855 CAGTGCAGAGGGGAAAATGTGGG + Intergenic
969570662 4:8006361-8006383 CTGTGGGGAGGTCATCAAGTGGG + Intronic
969848207 4:9936177-9936199 CTTTGGGGAGGTGATCAGGTCGG + Intronic
975671137 4:76781920-76781942 CTTTGTGGATGTGATAATTTTGG + Exonic
976347266 4:84018846-84018868 CTGGAGGGAGGTGATAAGGTTGG - Intergenic
977907622 4:102496765-102496787 CTGTGCGGAGCTCGTAATGTAGG - Intergenic
978234445 4:106441605-106441627 ATGTCCTGAGGTGACAATGTAGG - Intergenic
979429218 4:120607396-120607418 GTGTACAGAGGTGATTATGTAGG - Intergenic
982834674 4:160109220-160109242 CAGTGTGGAGGGGAAAATGTGGG - Intergenic
987147284 5:15004748-15004770 CTGTGCAGAGGTGGAGATGTGGG + Intergenic
992120416 5:73586640-73586662 CTGAATGGAAGTGATAATGTAGG + Intergenic
998327587 5:141295336-141295358 CTGTTGGGTGGTGAAAATGTTGG + Intergenic
999353434 5:150900540-150900562 CTCTGCCGATGTGTTAATGTTGG + Intronic
999371192 5:151056394-151056416 CTGTGAAGTGGTGATAATGAGGG + Intronic
1000294651 5:159902851-159902873 CTGGTGGGAGGTGAGAATGTGGG + Intergenic
1000505039 5:162106059-162106081 CATTGGGGAGGTGGTAATGTTGG - Intronic
1001704644 5:173733145-173733167 CTGTGGGGAGCTGATAAGGAAGG - Intergenic
1006230645 6:32583802-32583824 CTGTGGGGAGGTGACAAGGGAGG - Intronic
1008360066 6:50606623-50606645 CTCTGCAGAAGTGATAATGGAGG + Intergenic
1008374987 6:50781335-50781357 GTGTGGGGAGGGGATGATGTGGG - Intergenic
1011650479 6:89501896-89501918 CTGTGGGGAGGTGATGAGATGGG - Intronic
1013455276 6:110324261-110324283 CTGTGGGGATGTGAGACTGTGGG - Intronic
1016260372 6:142162403-142162425 CTGTGGGGAGATGACACTGTCGG + Intronic
1017825080 6:158075824-158075846 CTGAGAGGATGTGAGAATGTTGG - Intronic
1019873395 7:3788402-3788424 CTGTGCAGAGGGGATAAGGTGGG + Intronic
1021312466 7:19111115-19111137 CTGGGAGGGGGTGATATTGTGGG - Intronic
1021659056 7:22900236-22900258 ATGTGCTGAGGTTAAAATGTTGG + Intergenic
1023901722 7:44486491-44486513 GTGTGGGGAGATGATGATGTAGG + Intronic
1024630432 7:51242843-51242865 CTGTGCGGAGGTGATAATGTTGG - Intronic
1030456375 7:109779849-109779871 CTGGGTGGAGGTTATAATGAAGG - Intergenic
1035693438 8:1574696-1574718 CTGTGCTGAGTTGATAAAGTTGG + Intronic
1043551145 8:81374373-81374395 CTTTGAGGTGCTGATAATGTAGG + Intergenic
1046779043 8:118195678-118195700 TGGTGGGGTGGTGATAATGTTGG + Intronic
1051637190 9:19191217-19191239 CTGTGGGGAGGTAAATATGTGGG - Intergenic
1055008875 9:71541019-71541041 CTGTGAAGAGGTGAAATTGTGGG + Intergenic
1055681235 9:78717636-78717658 CTCTCCTGAGGTGATAATATAGG + Intergenic
1056090131 9:83197154-83197176 CTGTGCTGATGTGATAATAGAGG - Intergenic
1056939396 9:90942026-90942048 TTGTGAGGAGGTGACAATGGTGG - Intergenic
1058692445 9:107531128-107531150 GTGTGGGGTGGTGATAATATAGG + Intergenic
1060485134 9:124041672-124041694 CTGTGCCGTGGTGTTAGTGTGGG + Intergenic
1187520845 X:20012676-20012698 CTGTGTGAAGGTGATTATATGGG - Intronic
1189588349 X:42485035-42485057 CTATGGGGTGGTGGTAATGTAGG - Intergenic
1196044789 X:111246004-111246026 CTTTCCGGAGGTGATGATGGTGG + Exonic
1199659671 X:150036358-150036380 ATTTGCTGATGTGATAATGTTGG - Intergenic