ID: 1024632279

View in Genome Browser
Species Human (GRCh38)
Location 7:51259721-51259743
Sequence TCCCAGGCAGACTTCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024632276_1024632279 6 Left 1024632276 7:51259692-51259714 CCTTGGCTCATCCACATTTCAAA 0: 1
1: 0
2: 4
3: 24
4: 212
Right 1024632279 7:51259721-51259743 TCCCAGGCAGACTTCAGATGTGG 0: 1
1: 0
2: 4
3: 23
4: 186
1024632277_1024632279 -5 Left 1024632277 7:51259703-51259725 CCACATTTCAAAATGAGTTCCCA 0: 2
1: 3
2: 3
3: 38
4: 527
Right 1024632279 7:51259721-51259743 TCCCAGGCAGACTTCAGATGTGG 0: 1
1: 0
2: 4
3: 23
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024632279 Original CRISPR TCCCAGGCAGACTTCAGATG TGG Intronic
901349376 1:8579682-8579704 TGGCATGCAGATTTCAGATGGGG - Intronic
901661886 1:10803890-10803912 TCCCAGGCAGGCTGCTGAGGGGG - Intergenic
901746912 1:11379942-11379964 TCACTGGCAGACATCAGAAGAGG + Intergenic
906910487 1:49943779-49943801 TCCCAGCCAGAATTCAGGGGAGG + Intronic
910119488 1:83770160-83770182 TCTCAGGCTGACTTCAGAGCAGG - Intergenic
911694791 1:100877875-100877897 TCCCAGGAAGTTTGCAGATGTGG + Exonic
914355721 1:146882578-146882600 TCCCACGCAGACTCCAGACAGGG - Intergenic
914983667 1:152438708-152438730 TCCCAGGAACACTTTTGATGAGG + Intergenic
917517934 1:175723355-175723377 ACCCAGGTAGACTGCAGATAAGG - Intronic
918747710 1:188227224-188227246 TCCCAGGCACACTAAAGCTGAGG - Intergenic
919610040 1:199734050-199734072 TCAAAGGTAGAATTCAGATGTGG + Intergenic
922724411 1:227915737-227915759 TTCCAGGCTGACTTCAGAGACGG - Intergenic
924406468 1:243752919-243752941 TCCCAAGCAGACATCTGAAGTGG + Intronic
1062942175 10:1431983-1432005 TCCCCGCCACACTTCAGATTAGG + Intronic
1066552848 10:36578545-36578567 GCCCAGCAAGACTTCAGATGAGG + Intergenic
1066681359 10:37939082-37939104 TTCCAGGCAGACTGAATATGGGG - Intergenic
1067531513 10:47077557-47077579 TCCCCTGTAGACTTCAGAGGGGG - Intergenic
1067793987 10:49307641-49307663 TCCCAGGCAGAGTTGGGACGAGG - Intronic
1069924950 10:71842940-71842962 AGCCAGGTAGACTTCAGCTGTGG - Intronic
1070549381 10:77479328-77479350 TGCCAGGCAAACAACAGATGCGG + Intronic
1072269654 10:93763801-93763823 TCCCACGCTGACTTCACATTTGG + Intronic
1074467811 10:113698879-113698901 TCCCAGGCAGTATTCAGGAGGGG + Intronic
1075816125 10:125265838-125265860 TTCCAGGCATAGTGCAGATGTGG - Intergenic
1076057216 10:127385714-127385736 TCCCCTGCAGCCTTCAGAGGGGG - Intronic
1076260426 10:129060573-129060595 TCCCAGGAAGAATTCAGAGGAGG + Intergenic
1076329131 10:129652239-129652261 TCCCAGCCAGGCTTCAGAACTGG + Intronic
1076893419 10:133296314-133296336 ACCCAGGCAGACTTCGGAGAAGG - Intronic
1077555869 11:3225770-3225792 TTCCATGGAGACCTCAGATGAGG + Intergenic
1078522682 11:12075938-12075960 TCCCCTGCAGCCTTCAGAGGAGG - Intergenic
1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG + Intronic
1080519677 11:33056963-33056985 TCCCAGGCATACTTCAACTGAGG - Intronic
1083399943 11:62416552-62416574 TCCAAGGCAGACTGCAAAGGGGG - Intronic
1083472828 11:62895635-62895657 TCCCAGGTGGCCTTCAGATTTGG + Intergenic
1087018986 11:93583608-93583630 TCACACCCAGACTTCAGCTGTGG + Intergenic
1088909519 11:114180267-114180289 TCCCAGGTACCCTGCAGATGAGG - Intronic
1089536060 11:119161418-119161440 TCCCAGGCAGACAGCAGAGGAGG - Exonic
1090463685 11:126913739-126913761 TTCCAAGCAGACTTGAGAGGAGG - Intronic
1091155724 11:133370247-133370269 TCTCAGGCATACTGCAGTTGTGG + Intronic
1091862648 12:3800381-3800403 TATGAGGCAGATTTCAGATGTGG + Intronic
1091993824 12:4977336-4977358 TCCCAGGCAGCCTGCAGAAAGGG + Intergenic
1094118086 12:26938677-26938699 TCCCTCGCAGCCTTCAGCTGTGG - Exonic
1095108887 12:38269030-38269052 TCACATGCAAACTTCAGATTGGG + Intergenic
1099077381 12:78127634-78127656 ACCCATGCAGTCTACAGATGTGG + Intronic
1101449170 12:104760865-104760887 TTCCAGGCACACTTCACAAGTGG - Exonic
1102445205 12:112996968-112996990 TGGCAGGTAGACCTCAGATGAGG - Intronic
1103239289 12:119399542-119399564 TCCCAAGCAGACACCAGATGAGG - Intronic
1106032712 13:26017280-26017302 CCTCAGGATGACTTCAGATGTGG + Intronic
1108162773 13:47659996-47660018 CCCCAGTCAGTCCTCAGATGAGG - Intergenic
1109244280 13:59934508-59934530 TCCCTGACAGTCTTCAAATGGGG + Intronic
1111552539 13:89833602-89833624 TCCCGGACAGATTTCAGATTTGG + Intergenic
1113635020 13:111913446-111913468 TCCCTGGAAGCCTTTAGATGTGG - Intergenic
1114233276 14:20802655-20802677 GCCCAGGCAAACATCAGCTGGGG - Intronic
1122440990 14:101731704-101731726 TCCCAGGCTGCTTTCAGAGGAGG - Intronic
1124479197 15:30062956-30062978 TCCCAGGCAAACTGAAGGTGCGG + Intergenic
1125834837 15:42739833-42739855 GCCCACACAGAGTTCAGATGTGG + Exonic
1126711960 15:51468511-51468533 TCCCAAGCATCCTTCAGAGGAGG - Intronic
1131056116 15:89376115-89376137 TCTCAGGCAGCCTACAGGTGGGG + Intergenic
1131248268 15:90814547-90814569 CCCCAGGAAGGCTGCAGATGCGG - Intronic
1132179533 15:99741998-99742020 TCCTAGGCAGATGTCAGCTGGGG + Intergenic
1133081393 16:3323477-3323499 TCCCGGACAGACTTCAGATTTGG + Intergenic
1134035494 16:11027450-11027472 TCTCGGACAGACTTCAGATTTGG - Intronic
1135848406 16:25940054-25940076 TCCCAAGCAGACCTCGGAGGAGG + Intronic
1136480365 16:30537807-30537829 TCCCAGACAGACTTCAGATTTGG + Intronic
1137602032 16:49762765-49762787 GCTCAGTCAGCCTTCAGATGGGG - Intronic
1137784616 16:51127965-51127987 TCTCAGGGAGACTTGAGATAGGG + Intergenic
1138608256 16:58102752-58102774 TGCTAGCCAGACTTCTGATGTGG + Intergenic
1139978297 16:70832866-70832888 TCCCACGCAGACTCCAGACAGGG + Exonic
1140615963 16:76664320-76664342 TCCCAGGCAGGCTTTCCATGAGG - Intergenic
1141330220 16:83104184-83104206 GCCCAGGGAAACCTCAGATGTGG + Intronic
1141889872 16:86919384-86919406 TCCCAGGCAGCCTCAGGATGTGG + Intergenic
1141926787 16:87175131-87175153 TCCCAGGCAGAGGTGAGATGAGG + Intronic
1143406631 17:6682087-6682109 TCCCAGGTAGATGCCAGATGGGG + Intergenic
1146272566 17:31493938-31493960 TGTCAGGCAGCATTCAGATGGGG + Intronic
1146482025 17:33212434-33212456 TTCCAGGGAGCCTTCAGAAGGGG + Intronic
1147766830 17:42842515-42842537 TCCCAGCCAGTTTTCAGTTGGGG + Exonic
1147996999 17:44365313-44365335 TCCTGGACAGACTTCAGATTTGG + Intergenic
1148167418 17:45492985-45493007 CACCAGGCAGGCTCCAGATGGGG + Intergenic
1149009753 17:51843519-51843541 TCCAAGGGAGACTTCACGTGGGG - Intronic
1149737984 17:59014765-59014787 TACAAGGCAGAGTTCAGATAAGG + Intronic
1150133415 17:62681136-62681158 ACCCAGGCAGGCAGCAGATGTGG + Intronic
1151011917 17:70509221-70509243 TACCAGGTAGACTACAGATGAGG - Intergenic
1153773381 18:8433051-8433073 TGGCAGGCAGACCTCAGATGAGG - Intergenic
1157481288 18:48055566-48055588 TCCCAGGCTGCATTCAGAAGCGG - Intronic
1159374990 18:67581845-67581867 TCCCAGGCAAGATTCAGCTGAGG - Intergenic
1161480233 19:4506687-4506709 GCCCAGGCACTCTTCAGAAGGGG - Intronic
1168449934 19:56458519-56458541 TCCTGGACAGCCTTCAGATGGGG + Intronic
925263547 2:2548154-2548176 TCCCAGGCCGACCTAAGCTGAGG + Intergenic
929231755 2:39567490-39567512 TCTCAGGCAGACTTCATCTACGG + Intergenic
932700765 2:73989711-73989733 TTCCAGGAAGACTTTAGAGGAGG + Intronic
932919046 2:75888952-75888974 ACCCAGGCAGATTGCAGAAGAGG - Intergenic
933567622 2:83970421-83970443 TCCCAGGCAGAAAGCACATGAGG - Intergenic
936154313 2:110038123-110038145 TGGCAGGCAGACCTCAGATAAGG + Intergenic
936190370 2:110333292-110333314 TGGCAGGCAGACCTCAGATAAGG - Intergenic
937254041 2:120542062-120542084 TCCCAGGGACACTGCAGATCTGG + Intergenic
938073998 2:128322428-128322450 TCCCAGGCAGCCCGCAGACGCGG + Intergenic
939027046 2:137026375-137026397 TCCCAAACTCACTTCAGATGTGG - Intronic
940323650 2:152402498-152402520 TTCAAGGCAGAATTCAGTTGAGG - Intronic
941647481 2:168056900-168056922 TCCAAAGTAGACTTCAAATGGGG + Intronic
944427972 2:199603594-199603616 TCCCAGGAAGACTTGAAGTGGGG - Intergenic
944783141 2:203040534-203040556 TCCCGCACAGACTTCAGATTTGG - Intronic
946037129 2:216753005-216753027 TCCCAGACAGACTTCTGAGAGGG - Intergenic
946049797 2:216853133-216853155 AACCAGGCAGGCATCAGATGGGG - Intergenic
946150274 2:217760847-217760869 TCCCAGACAGATTTCAGACTTGG + Intergenic
946193011 2:218017324-218017346 CCCCAGGCAGACCACAGATGAGG + Intergenic
947897545 2:233689703-233689725 TGGCAGGCAGACCTCAGATAAGG - Intronic
948248105 2:236503520-236503542 CCCCAGACAGACTGCAGTTGGGG - Intronic
948709704 2:239818160-239818182 TGCCAGACAGTCATCAGATGGGG - Intergenic
948768516 2:240235547-240235569 TCCCAGGCAGGTTGCAGCTGGGG - Intergenic
1168851339 20:979119-979141 TCCCAGACATATTTCAGAAGTGG - Intronic
1169190701 20:3657585-3657607 TCCCAGGCAGAACCCTGATGGGG - Intergenic
1170804874 20:19620796-19620818 TGCAAGGCAGACTGCAAATGAGG - Intronic
1173543049 20:43869047-43869069 TCCCAGGCAGCCAACAGAAGAGG + Intergenic
1176028502 20:62998782-62998804 AGACAGGCAGACATCAGATGGGG - Intergenic
1176237382 20:64059911-64059933 TCCCAGGGAGAAATCAGGTGGGG + Intronic
1176298054 21:5084879-5084901 CCCCAGGAGGACTGCAGATGGGG + Intergenic
1177198389 21:17927325-17927347 TCCTAGGCAGATTATAGATGAGG + Intronic
1177684143 21:24415589-24415611 TCCCAGGCACATTTCAAATTTGG + Intergenic
1179278397 21:39912558-39912580 ACCTAGGCAGAATTCAGATGGGG - Intronic
1179858975 21:44177070-44177092 CCCCAGGAGGACTGCAGATGGGG - Intergenic
1180974976 22:19843377-19843399 TCCCAGGAAGAATTCCGGTGAGG + Intronic
1181487525 22:23241170-23241192 CCCCAGGCATCCTTCAGAAGCGG + Intronic
1183046008 22:35220763-35220785 TTCCAGGAAGACTGCAGAGGGGG + Intergenic
1184276009 22:43410259-43410281 TCCCAGGCAGGCGGCAGGTGGGG + Intergenic
1184649615 22:45913539-45913561 TCCCAGGTATCCTTCAGGTGTGG - Intergenic
952799556 3:37275851-37275873 TCGCAAGCAGAGTACAGATGAGG + Intronic
953903042 3:46854034-46854056 TCCCATGCAGAATTCTGAAGGGG + Intergenic
956196800 3:66661274-66661296 TGCCAGGCAGAGTTCTGATGAGG + Intergenic
956198891 3:66684557-66684579 TACCAGGAAGAGTTCAGAGGGGG - Intergenic
962823968 3:139081946-139081968 TCCTGGACAGACTTCAGATTTGG + Intronic
962931360 3:140040590-140040612 CCCCGGGCAGAATTCAGATGAGG - Intronic
964856468 3:161151123-161151145 TGGCACGCAGACTTCAGATAAGG - Intronic
966678099 3:182611099-182611121 TCCCAGAGAGACTTCAGATTTGG - Intergenic
968452704 4:682715-682737 TCCCAGGGAATCTTCACATGGGG + Intronic
968595427 4:1479779-1479801 TCCCAGGTAGAGATCACATGGGG + Intergenic
968667894 4:1831247-1831269 TCCCAGGCATATTTTAGAAGTGG + Intronic
969089841 4:4685466-4685488 GCCCAGGCTGGCTCCAGATGGGG - Intergenic
969837923 4:9858622-9858644 TCCCCGGCAAACTACTGATGAGG + Intronic
970520786 4:16881747-16881769 TCCACTGAAGACTTCAGATGTGG - Intronic
972241415 4:37197313-37197335 TTCCCTGAAGACTTCAGATGAGG - Intergenic
975702795 4:77082691-77082713 TCCTGGACAGACTTCAGATTTGG + Intergenic
977698230 4:99991029-99991051 TCCCAGACAGACTTCAGATTTGG + Intergenic
978598058 4:110400064-110400086 TCCCGGACACACTTCAGATTTGG + Intronic
978980329 4:114937349-114937371 TACCGGGCAGGTTTCAGATGTGG + Exonic
979082034 4:116357875-116357897 GCCAAGGCAGGCTTCTGATGTGG + Intergenic
982027070 4:151261466-151261488 CTTCAGGTAGACTTCAGATGAGG - Intronic
982202309 4:152972921-152972943 TTCCAGGGAGACTTCTGTTGTGG + Intronic
983801764 4:171939935-171939957 TCCTAAGTAGACTTCCGATGAGG + Intronic
984825942 4:183924604-183924626 TCCCAGACAGACTTGAGGTAGGG + Intronic
985306189 4:188543131-188543153 TCCCAGGCATCCTTCAGGTCAGG + Intergenic
985676542 5:1234421-1234443 TCCCAGCCACACTCCAGAAGCGG + Intronic
986273309 5:6252781-6252803 TCCCTGGGTGACTTTAGATGTGG - Intergenic
986322529 5:6644538-6644560 TCCTAAGCTGACTTCAGAAGTGG + Intronic
987471124 5:18329577-18329599 TCACAGGCTGAATTCAGATGAGG - Intergenic
992031474 5:72725840-72725862 TCTCGGACAGACTTCAGATTTGG - Intergenic
995414182 5:111890544-111890566 GCCCAGGCAGAGTTTGGATGGGG - Intronic
995848097 5:116515741-116515763 TCCCAGGCAGAGTGGAGATCAGG - Intronic
995956182 5:117779115-117779137 TACCAGACAGACTTCAGATTTGG + Intergenic
998577518 5:143332925-143332947 TCTCGGACAGACTTCAGATTTGG - Intronic
999220970 5:149977228-149977250 TCCCAGGCAGACTGCAAAATAGG - Intronic
999301390 5:150492811-150492833 GCCCAGGCAGAGGCCAGATGAGG + Intronic
1000867729 5:166536198-166536220 TCTGTGGCAGATTTCAGATGAGG + Intergenic
1001422675 5:171599453-171599475 TCCCAGGCAGACTGCAGGCTGGG - Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1002547372 5:179958555-179958577 TCACAGGCCGACCTCAGATCAGG - Intronic
1003618042 6:7673070-7673092 TCCCGGGCAGCCTTCAGCAGTGG + Intergenic
1003699714 6:8448288-8448310 TCACAGGCAGCCTCCAGAAGCGG - Intergenic
1006473120 6:34238936-34238958 CCCCAGGCAGACCTTATATGAGG + Intronic
1007315712 6:40987008-40987030 TTCCACGCAAGCTTCAGATGAGG - Intergenic
1007570393 6:42885978-42886000 TCTCGGACAGACTTCAGATTTGG - Exonic
1007998644 6:46335569-46335591 TCCCAAGCAGTCTTGAGATGAGG + Intronic
1010721834 6:79291363-79291385 ACCAAGGCAGACTACAGATTGGG + Intergenic
1012552516 6:100477033-100477055 TCCATGGCAGAGTACAGATGGGG + Intergenic
1013353538 6:109327467-109327489 TGCCAGACAGACTTCGGATTTGG + Intergenic
1014727119 6:124984436-124984458 TACCAGGGAGACTTGAGGTGTGG + Intronic
1015510987 6:134037878-134037900 TCCCAGGGAGAGTTCTGGTGTGG + Intronic
1016843254 6:148544892-148544914 TACCGGGCTGGCTTCAGATGTGG - Intronic
1016918644 6:149268404-149268426 TCCTAGGTAGACTACAGAAGAGG + Intronic
1019653203 7:2171912-2171934 TCCCAGGGACCCTCCAGATGTGG - Intronic
1021500752 7:21329907-21329929 TCTCAGCCAGACTTGAGAAGAGG - Intergenic
1024632279 7:51259721-51259743 TCCCAGGCAGACTTCAGATGTGG + Intronic
1024790386 7:52958958-52958980 TCCCAGGCAGAATCTGGATGAGG + Intergenic
1024843003 7:53609391-53609413 TCCCAGGCAGAAATAAGCTGAGG + Intergenic
1029073198 7:97916662-97916684 TCCCAAGCAGCATTCAGAGGTGG + Intergenic
1030892860 7:115022244-115022266 TCCCAACCATACATCAGATGTGG + Intergenic
1031469448 7:122151591-122151613 TCCCAGCCAACTTTCAGATGTGG + Intergenic
1032706156 7:134422739-134422761 TCCCAGGCAGGCTGGAGCTGAGG - Intergenic
1032876624 7:136045265-136045287 TCCCAGGTAGACATCAGAGGAGG + Intergenic
1034817651 7:154186939-154186961 GCCCAGTCAGCCTTCAGCTGTGG - Intronic
1036703812 8:11031651-11031673 TTTCATGCAGATTTCAGATGAGG + Intronic
1040019286 8:42725782-42725804 TCCCAGACAGACTTCAGATTTGG + Intronic
1041057324 8:53999996-54000018 TCGCAAGCAGAGTACAGATGAGG - Exonic
1041821400 8:62038006-62038028 TCCCATTCAGATTTTAGATGTGG - Intergenic
1043455949 8:80412348-80412370 ACCCAGGGAGACTTCAGCAGTGG - Intergenic
1044367672 8:91368391-91368413 TGCAAGGGAGATTTCAGATGAGG + Intronic
1047364583 8:124200421-124200443 CCCCACCCCGACTTCAGATGGGG + Intergenic
1048649196 8:136455390-136455412 TCCCAAACAGCCTTCAGATGGGG - Intergenic
1049108725 8:140629701-140629723 TCCCAGGTAGACTGCAGCTGTGG - Intronic
1049564120 8:143329075-143329097 TCCCAGGCAGGCTGTGGATGTGG - Intronic
1054818557 9:69498966-69498988 TTCCAGGCAGACCTCAGAAAAGG - Intronic
1055779399 9:79803146-79803168 TGGCAGGCAGACTTCGGAAGTGG - Intergenic
1056189539 9:84171310-84171332 TCTCAGGGAGACTTCATCTGGGG - Intergenic
1057694568 9:97314072-97314094 TGCCAGGTTTACTTCAGATGAGG - Intronic
1059554304 9:115263616-115263638 TTGCAGGCAGACTTATGATGTGG + Intronic
1061365117 9:130168599-130168621 CCCCAGGAAGTCTTCAGATGGGG + Intergenic
1061365516 9:130170987-130171009 CCCCAGGAAGTCTTCAGATGGGG - Intergenic
1061934089 9:133847618-133847640 TCCCAGGCAGACCCCACTTGAGG + Intronic
1185519497 X:728223-728245 TCTCAGGCAAGCTTCAGAAGAGG + Intergenic
1187914764 X:24143007-24143029 TCCAAGGCAATTTTCAGATGAGG + Intergenic
1189046301 X:37595135-37595157 TCCTAGGGAGCCTTCAGCTGAGG + Intronic
1189893324 X:45628327-45628349 TGGCAGGCAGACCTCAGATAAGG - Intergenic
1190140721 X:47841255-47841277 TCCCGGACAGACTTCAGATTTGG + Intronic
1190380764 X:49837734-49837756 TCCCAGACAAAATTCAGATTTGG - Intergenic
1199497140 X:148465114-148465136 TCCCAGACAGACTTCAGATTTGG - Intergenic
1200081255 X:153577719-153577741 TCCGAACCAGATTTCAGATGGGG + Intronic