ID: 1024637967

View in Genome Browser
Species Human (GRCh38)
Location 7:51306061-51306083
Sequence TTGTACTTGATGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024637954_1024637967 30 Left 1024637954 7:51306008-51306030 CCCAGGCGACAGAGCAGCAAGAC 0: 1
1: 4
2: 25
3: 78
4: 371
Right 1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG 0: 1
1: 0
2: 1
3: 28
4: 264
1024637955_1024637967 29 Left 1024637955 7:51306009-51306031 CCAGGCGACAGAGCAGCAAGACT 0: 2
1: 2
2: 10
3: 14
4: 141
Right 1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG 0: 1
1: 0
2: 1
3: 28
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024637967 Original CRISPR TTGTACTTGATGAATGAAGA TGG Intronic
901727831 1:11256133-11256155 TTGCACTTGCTGGAAGAAGAAGG + Exonic
902645101 1:17792361-17792383 TGGTACTTTATAAATGGAGAGGG - Intronic
905055223 1:35087759-35087781 TTTTACTTTAAGAATGAATATGG + Intronic
906241566 1:44245342-44245364 TTGTAGTCTTTGAATGAAGAGGG - Intronic
909350629 1:74649173-74649195 TTGGACTTAATGAAACAAGAAGG + Intronic
909367354 1:74843237-74843259 TTTTACTTCATGATTTAAGATGG - Intergenic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
911095925 1:94055036-94055058 TTAAACTAGATGAATGGAGAGGG + Intronic
911905469 1:103562931-103562953 TGGTACTTGATGTGTCAAGAGGG + Intronic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918720744 1:187849786-187849808 TGTTATTTGATGAATGAAGAGGG - Intergenic
919722942 1:200860152-200860174 TTTTACTTTATTAATGCAGAAGG + Exonic
923359191 1:233191360-233191382 TTGTACTTGATTAATGGAAACGG - Intronic
924797016 1:247300034-247300056 TTGGACTAGAGGAAAGAAGAAGG - Exonic
1063247990 10:4243168-4243190 CTTTATTTGATAAATGAAGATGG - Intergenic
1063607734 10:7537563-7537585 TTGTAGTTGTTAAATCAAGAGGG + Intergenic
1065428842 10:25633161-25633183 TTGTACTTTATTAATAAAAATGG - Intergenic
1066224275 10:33367063-33367085 CTGGCCCTGATGAATGAAGAAGG - Intergenic
1066401016 10:35076145-35076167 TTCTACTAAGTGAATGAAGAGGG + Intronic
1066401124 10:35077218-35077240 TTCTACTAAGTGAATGAAGAGGG + Intronic
1067971155 10:50972515-50972537 TTCTACTTGATGAAGGAACAAGG + Intergenic
1069716823 10:70526457-70526479 ATGTACTTGATGGATGAAATTGG + Intronic
1070724634 10:78779697-78779719 CTATAGTTGAGGAATGAAGAGGG - Intergenic
1070948930 10:80415347-80415369 TTGAACTTGAGGTATGGAGATGG + Intronic
1071110685 10:82151660-82151682 CTGGTCTTGATGAATGAAGAAGG + Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1076575807 10:131466368-131466390 TTCTGCTTGATGAAAGAAAATGG - Intergenic
1077345412 11:2047200-2047222 TGGTGCTTGAAGAATGGAGAAGG - Intergenic
1077598131 11:3552179-3552201 TTAAACTTTATGAATGATGAGGG + Intergenic
1078212015 11:9277461-9277483 TTGGATTTGATAAATGAGGATGG - Intergenic
1078324126 11:10365419-10365441 TTGTACTTGGTGTCTGAAGTTGG + Intronic
1079216150 11:18513763-18513785 TTATTCTTGATGAAGGATGAAGG - Intronic
1079616702 11:22503315-22503337 GTGTAATTGATGACTGAATAAGG - Intergenic
1083005164 11:59337654-59337676 TTGTCTTTGATGAATTAAAATGG + Intergenic
1084289794 11:68154985-68155007 TTGTACTGAAAGAATGAAAAAGG - Exonic
1084994658 11:72964505-72964527 TTGCCCTTAAGGAATGAAGAAGG - Intronic
1085178443 11:74511220-74511242 TTCTCCTTGATAAAAGAAGAGGG + Intronic
1085417793 11:76330772-76330794 CTGGACCTGAAGAATGAAGAGGG - Intergenic
1085979794 11:81710447-81710469 TTGGACTTGACGATTGAAGATGG - Intergenic
1086159441 11:83705132-83705154 TTGTACTTTCTGAATGCAGGTGG + Intronic
1086600659 11:88629512-88629534 TTGTCCGTGATCAATAAAGAAGG - Intronic
1086814470 11:91351620-91351642 TTGAGTATGATGAATGAAGAAGG - Intergenic
1086969339 11:93064261-93064283 TACTAGTTGATGAATGTAGAAGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1091245682 11:134092516-134092538 TGGAACATGATGAATAAAGAGGG - Intronic
1091245757 11:134093126-134093148 TAGAACATGATGAATAAAGAGGG - Intronic
1093613649 12:21194185-21194207 TTGTACTTTATTAGTGGAGACGG + Intronic
1093919327 12:24842084-24842106 CTTTACTGGATAAATGAAGATGG - Exonic
1095078861 12:37971449-37971471 TTGTACTTGTTAGCTGAAGATGG - Intergenic
1095142947 12:38689116-38689138 TTGTTGTTTATTAATGAAGAGGG + Intronic
1095933318 12:47651008-47651030 CTGTCCTTGATGTAGGAAGATGG + Intergenic
1097391185 12:59015739-59015761 TTGTATTTTTTGAATGACGATGG + Intergenic
1098566358 12:71941680-71941702 TTCTCCTTGAAGAATGAAGTTGG + Exonic
1099264556 12:80428984-80429006 TAATACTTGGTGACTGAAGAAGG - Intronic
1099278377 12:80608085-80608107 TAGGACTTGACGAATGAATAGGG + Intronic
1100104990 12:91159215-91159237 ATGTTCATGATCAATGAAGATGG - Intronic
1100125456 12:91419525-91419547 TTATGCTTGATAAATGAAGAGGG - Intergenic
1100706041 12:97201517-97201539 TTGTATTTGATGAGTGAAGGTGG + Intergenic
1101607481 12:106258630-106258652 TTCTACTTGAGAAAAGAAGAGGG + Intronic
1103709178 12:122898251-122898273 TTATACTTGGTGAAGAAAGATGG + Intergenic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104620566 12:130308809-130308831 TTGTCCTTTCTGAAGGAAGAGGG + Intergenic
1105600670 13:21884291-21884313 TGGGACTTGATGAATCCAGATGG + Intergenic
1106002103 13:25733783-25733805 TTGTATTTGAGGAAAGGAGATGG - Intronic
1107329323 13:39281748-39281770 GTGTGCTTGATGAATGATCATGG + Intergenic
1108138004 13:47386093-47386115 TTCTACTTGAGAAAAGAAGAGGG + Intergenic
1108275157 13:48800831-48800853 TGGAACATGAAGAATGAAGAGGG + Intergenic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1110483189 13:76006967-76006989 TTAGACTTGATGATTAAAGATGG - Intergenic
1112127701 13:96487046-96487068 TTGTAATTGATAATTGAACAGGG - Intronic
1112567135 13:100561425-100561447 TAATAGTTGATGGATGAAGATGG + Intronic
1112689960 13:101881400-101881422 TTGTATGTGATGAATAAATAAGG - Intronic
1112971266 13:105266157-105266179 TTGTACTTGAACAATATAGATGG + Intergenic
1113368455 13:109700442-109700464 TTCTTTTTTATGAATGAAGATGG - Intergenic
1113396570 13:109953673-109953695 AGATCCTTGATGAATGAAGATGG + Intergenic
1116234380 14:42259271-42259293 ATGTACTGAATGAATAAAGAAGG - Intergenic
1116354821 14:43914769-43914791 TTGTGCTTGAGGAAAGGAGAGGG + Intergenic
1117418869 14:55523944-55523966 TTGTATTTTTTTAATGAAGACGG - Intergenic
1117843022 14:59880752-59880774 TTCTGCTTGAGGAAAGAAGAGGG - Intergenic
1119421380 14:74509748-74509770 GGGTACTGGGTGAATGAAGACGG - Exonic
1120426176 14:84351043-84351065 TTCTACTTGAAGAAAGGAGAAGG + Intergenic
1121091490 14:91185899-91185921 TTGTTCTTGAGGATTAAAGATGG - Intronic
1121469612 14:94141951-94141973 TTGTACATGATAAATTTAGATGG + Intergenic
1123784682 15:23658715-23658737 TTGTATTTGGTGAATGATAAGGG - Intergenic
1125567105 15:40685188-40685210 TTCTACTTGAGGAAAGAGGAGGG - Intergenic
1125597914 15:40899395-40899417 TTGTACGTGCTAAATGAAGAAGG + Exonic
1127400387 15:58579674-58579696 TTGTAATCTATGAATAAAGAAGG - Intergenic
1129809159 15:78492883-78492905 TTGTACCTAAAAAATGAAGAAGG + Intronic
1131368978 15:91864027-91864049 TTGCACTTGATGGAAGCAGATGG + Intronic
1133089782 16:3395145-3395167 TGGGACTTAAAGAATGAAGATGG - Intronic
1133641764 16:7724005-7724027 TTTTACTTGCTGAAGGAAGCTGG - Intergenic
1133944808 16:10339226-10339248 TTCTACTTGAAGAATGAATAGGG - Intronic
1134347465 16:13404155-13404177 TTGTTATTGTTGAGTGAAGAAGG - Intergenic
1139841516 16:69884874-69884896 TTGTAGCTAATAAATGAAGAAGG + Intronic
1140714173 16:77706946-77706968 TATTACTTGTTGAATGAATATGG + Intergenic
1140988868 16:80188662-80188684 TTGTCCTGGAAGAATGGAGATGG - Intergenic
1141309411 16:82898707-82898729 TTTTACCTGATGGATGAAGCAGG + Intronic
1141333906 16:83137235-83137257 TTGCACTTGCTGCATGAAGTTGG - Intronic
1144603050 17:16636362-16636384 TTTTAGCTAATGAATGAAGAAGG + Intronic
1146605944 17:34257704-34257726 TTATTATTTATGAATGAAGAAGG + Intergenic
1147842672 17:43383044-43383066 TGGGACTTGATGACTGAAGGAGG + Intergenic
1149004795 17:51794321-51794343 TTCTACTGGTAGAATGAAGAAGG - Intronic
1149188538 17:54030726-54030748 TTGTGCTTAAGGAAAGAAGAGGG + Intergenic
1149630656 17:58119597-58119619 TTGTACTTGTTTAAGGAATAGGG + Intergenic
1153957564 18:10110967-10110989 TTATATCTGATGAATGAAGCTGG - Intergenic
1156014187 18:32528713-32528735 TTGTAGGGGATGGATGAAGAGGG + Intergenic
1157296692 18:46450133-46450155 TGGTTCTTGATGAAAGAAAAGGG + Intronic
1157997767 18:52579905-52579927 TTGTACTGGATCAAGAAAGAAGG + Intronic
1158637730 18:59176338-59176360 TTCTACTGGAGGAATGAAGCTGG - Intergenic
1159329737 18:66976435-66976457 TATTACTAGATGAATCAAGATGG + Intergenic
1159593685 18:70361945-70361967 TTGCATTTGATAAATGAGGAAGG + Intergenic
1160099986 18:75911581-75911603 TACTACTTGTTGAATAAAGAAGG - Intergenic
1164797652 19:31047112-31047134 TTGTACCTGTTGACTGTAGATGG - Intergenic
1166006922 19:39914435-39914457 TGGTGCTTTAGGAATGAAGAGGG - Intronic
1167903324 19:52638195-52638217 TTGTCCTGGGTGAAGGAAGAAGG + Intronic
1167938020 19:52923249-52923271 TTGCTCTTGTTGAAGGAAGAAGG + Intergenic
926817233 2:16811228-16811250 TTTACCTTGAGGAATGAAGATGG - Intergenic
928564604 2:32532086-32532108 TTGTGTTTGTTGAATGAAGTAGG + Intronic
930681702 2:54263884-54263906 TTGGATTTGATGACTGAAGCTGG - Intronic
930895487 2:56441003-56441025 TTCTACTTGAGGAAAGAAGTGGG - Intergenic
931261856 2:60626975-60626997 ATTTACCTGATGAATGAAGAGGG + Intergenic
931652694 2:64482827-64482849 TTTGACTTGAAGACTGAAGAAGG + Intergenic
932690296 2:73907421-73907443 TCGTACTTGATCACTGAAGAAGG + Intronic
932845207 2:75128160-75128182 TTGCAACTGCTGAATGAAGATGG - Intronic
933473170 2:82753922-82753944 TTGGATTTGTTGAGTGAAGAGGG + Intergenic
934866605 2:97819690-97819712 TTGTATTTGTTGAATTATGAAGG + Intronic
935794292 2:106626294-106626316 TTCTAGTTAATGAATGTAGAAGG - Intergenic
935989433 2:108705845-108705867 TTCTGCTTGATGAAAGGAGAGGG + Intergenic
936003246 2:108856829-108856851 TTGGACTTGAAGACAGAAGAAGG + Exonic
937033041 2:118756798-118756820 TTGTTCTTGAAGAATGCAGGTGG - Intergenic
937515604 2:122651857-122651879 TTGTATTTAATGACTGAAGTTGG + Intergenic
938221959 2:129576749-129576771 TTTTAGTTTATAAATGAAGAAGG - Intergenic
938833992 2:135080743-135080765 TGGTTCTTGGTGACTGAAGAAGG + Intronic
940397483 2:153207519-153207541 TTGTAGCTGATAAATGAAGAAGG - Intergenic
940473443 2:154129778-154129800 TTTTAATTGATTAATGAACATGG + Intronic
941506611 2:166353925-166353947 AAATGCTTGATGAATGAAGATGG + Intronic
941952867 2:171174934-171174956 TTGTACTTACTGAGTGAAGTTGG - Intronic
942734774 2:179097197-179097219 TTGCACTTGAAGAGAGAAGATGG - Intergenic
943442828 2:187947261-187947283 TTGTATGTTATGATTGAAGAGGG + Intergenic
943562625 2:189482188-189482210 TCCTATTTGTTGAATGAAGATGG + Intergenic
944691040 2:202158752-202158774 TGGTAATTGATGAATGAATAAGG + Intronic
945201844 2:207289703-207289725 GAGTATTTGATGAATGATGAGGG - Intergenic
946602879 2:221371380-221371402 TTGAAGTTGAGGAAAGAAGATGG + Intergenic
1169666310 20:8040527-8040549 TTCTAATTAATGAATGTAGAAGG - Intergenic
1169792454 20:9426046-9426068 TTGTTCCTGTGGAATGAAGAGGG - Intronic
1171246072 20:23610783-23610805 TTGTACTGGCTGTATGAAGGAGG + Intergenic
1173175073 20:40758762-40758784 GTGTTATTGATAAATGAAGATGG - Intergenic
1173378411 20:42511929-42511951 TTGTACATCATGAATGAACAAGG + Intronic
1175224518 20:57437270-57437292 TTGAGCTTGATCAGTGAAGAAGG - Intergenic
1177115934 21:17087335-17087357 TTGTACTTAATTAGTGAAAAGGG + Intergenic
1177749599 21:25263671-25263693 TTGTGCTGAATGAATGTAGAAGG - Intergenic
1177968360 21:27757972-27757994 ATGTACTTGATGAGAGCAGACGG - Intergenic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1180171349 21:46060270-46060292 TTGTGCTTGCTGAAGGCAGATGG - Intergenic
1180720246 22:17902603-17902625 TTATACTGGAGGAGTGAAGAAGG - Intronic
1184584395 22:45437594-45437616 TTGGACTTCAAGAATGAAGCCGG - Intergenic
951011368 3:17684707-17684729 TTATATTTAATGAATGAAAATGG - Intronic
952360698 3:32627425-32627447 TTGCAATTGGTGACTGAAGAGGG - Intergenic
953227782 3:41036033-41036055 TTGCATTTGGTGAATGTAGACGG - Intergenic
954722429 3:52576629-52576651 TTCTTCTGGGTGAATGAAGATGG + Exonic
955779979 3:62474116-62474138 TTCTACATGATCAATGAAGAGGG + Intronic
964999935 3:162940503-162940525 TTCTGCTTGATGAATGGAGAGGG + Intergenic
965697841 3:171427959-171427981 TTGAGCTTGAGGAATGAGGAGGG + Intronic
965741444 3:171879292-171879314 TTGAACTAGATGAATGAATGAGG - Intronic
966318359 3:178674063-178674085 AAGTAATTGATGGATGAAGAGGG - Intronic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
967236467 3:187389343-187389365 TTCTATTTGAAGAATGATGATGG - Intergenic
968429224 4:545443-545465 TTCTGCTTGATGAGAGAAGAGGG - Intergenic
970080155 4:12273767-12273789 TTGTAAATGAGGTATGAAGAGGG + Intergenic
970427304 4:15957200-15957222 GAGTACTTGATTAATAAAGATGG + Intergenic
970630144 4:17932927-17932949 TTCTATTTCATGTATGAAGATGG - Intronic
971117630 4:23666390-23666412 TTTTATTTAATGAATGAAGGAGG + Intergenic
972113080 4:35590853-35590875 ATGTCCTTGATGAATGAATAGGG - Intergenic
972796401 4:42425544-42425566 TTGTATTTTTTGGATGAAGAGGG + Intronic
973801058 4:54479113-54479135 TAGGACTTGAAGAATGAATAAGG - Intergenic
974593308 4:63983737-63983759 TTCCACTTGAGGAATGGAGAAGG - Intergenic
974663891 4:64932841-64932863 TTGTATTTGATTAATGTAAATGG + Intergenic
975314290 4:72933505-72933527 TTGTGGTTGAGGAAAGAAGAGGG - Intergenic
975324403 4:73043125-73043147 TTGGACTTGAGGATGGAAGAAGG + Intergenic
975369548 4:73568640-73568662 TTGTGCTTGAGGAGGGAAGAAGG - Intergenic
975715819 4:77205110-77205132 TTTTACTTCATGAATGTATATGG + Intronic
976137900 4:81958839-81958861 TTGTACTTAATGGAAGCAGAGGG + Intronic
976473216 4:85453786-85453808 ATGTATCTGATAAATGAAGATGG - Intergenic
977085680 4:92595020-92595042 ATGTATTTGATGTATTAAGAAGG + Intronic
977235362 4:94501793-94501815 ATGCCCTTGATGAATGATGATGG - Intronic
977863405 4:101994565-101994587 TTGTACATGGTGCATGAAAATGG + Intronic
978107065 4:104916185-104916207 TTCTACTGGTTGAATGTAGAGGG - Intergenic
979165573 4:117525743-117525765 TTGTATTTGAGGATTGAGGAGGG - Intergenic
980461474 4:133120662-133120684 ATGTACTAGATGAGTGAAAAAGG - Intergenic
983873982 4:172854659-172854681 TTGGCCTTGAAGAATGGAGAGGG - Intronic
984100840 4:175483844-175483866 TTGAAGTTGACAAATGAAGAGGG + Intergenic
984487883 4:180395344-180395366 TTGTACTTTATCAATGAACATGG + Intergenic
986258062 5:6118176-6118198 GTGCACTTAATTAATGAAGATGG - Intergenic
987081103 5:14426335-14426357 TTGTATTTGATGAAATGAGACGG - Intronic
987626556 5:20408158-20408180 TTGTTCTTCAAAAATGAAGAGGG + Intronic
987893839 5:23918772-23918794 TTGTACATGATGAAAGAAAGTGG - Intergenic
991443473 5:66675827-66675849 GTCTACATGATGAATAAAGAAGG + Intronic
993346562 5:86790917-86790939 CTGAAATGGATGAATGAAGAAGG - Intergenic
994529922 5:100956433-100956455 TTCTGCTTGAGGAAAGAAGAAGG + Intergenic
995146850 5:108796607-108796629 TTCTACTTGAGGAAAGGAGAGGG - Intronic
995488900 5:112669159-112669181 TTTTACTTTATGATTGAAGGTGG - Intergenic
997983098 5:138482333-138482355 TTGTACATGGGGAATGAAGATGG - Intergenic
998608049 5:143657072-143657094 TTGGACTTAATGAATAAAGAGGG + Intergenic
999379442 5:151109989-151110011 TTGTGCTTGAGGAAGGAAGAGGG - Intronic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1001713793 5:173798375-173798397 TTGTACTGGAGGAAGGAAGAGGG + Intergenic
1003020867 6:2508308-2508330 TTGTTCTTGGCGATTGAAGATGG + Intergenic
1003941405 6:11030900-11030922 TTATATCTGATGAATGAACAGGG - Intronic
1005297048 6:24436890-24436912 TTGCTATTGATGAATGAAGTAGG - Intronic
1007716034 6:43856713-43856735 TGATACTGAATGAATGAAGAGGG - Intergenic
1008635536 6:53406923-53406945 TTGTTCTGAATGAATGAAGGTGG - Intergenic
1010265147 6:73857382-73857404 GTGTACTGGATAAAGGAAGAGGG - Intergenic
1010528837 6:76941781-76941803 TTCTGCTTGAGGAAAGAAGAGGG + Intergenic
1010947222 6:81989768-81989790 TTGTAGATATTGAATGAAGATGG - Intergenic
1011790405 6:90892859-90892881 TGCTATATGATGAATGAAGAAGG + Intergenic
1012136374 6:95562101-95562123 TTCTCCTTCTTGAATGAAGAGGG + Intergenic
1012250885 6:96979313-96979335 TTGTACCTGGTGAAAGAAAAGGG + Intronic
1013412160 6:109892031-109892053 ATGTACATGATGTAAGAAGAAGG - Intergenic
1013925671 6:115468694-115468716 TTCTACTTGAGGAAAGGAGAGGG - Intergenic
1014218871 6:118780203-118780225 TTGTATTTACTAAATGAAGAAGG - Intergenic
1014394664 6:120911287-120911309 TTGTCATCTATGAATGAAGACGG + Intergenic
1014399877 6:120975144-120975166 TTGCATTTGAAGAATAAAGAAGG - Intergenic
1014610782 6:123542177-123542199 TTGTACTTGATGCATGTCAATGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1014901808 6:126974923-126974945 ATGTGCTTCATGAATCAAGATGG - Intergenic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1015945713 6:138498494-138498516 TTATACTGGATAAATGAACATGG - Intronic
1019116795 6:169771618-169771640 GAGGACTTGAGGAATGAAGATGG - Intronic
1020498614 7:8888722-8888744 TTCTACTTAATGAAAGGAGAAGG - Intergenic
1021416129 7:20387206-20387228 TTCTACTTTATAAATGAGGAGGG + Intronic
1021824437 7:24534197-24534219 TTGTACCAGATGTATAAAGAAGG - Intergenic
1024395487 7:48862062-48862084 TTATAATTTATGAATGAAAAAGG + Intergenic
1024399744 7:48910214-48910236 TTATAATTTATGAATGAAAAAGG - Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1025479020 7:60959458-60959480 GTGTGCATCATGAATGAAGACGG - Intergenic
1026138820 7:67687026-67687048 TTGTTCTTGATACATTAAGAAGG - Intergenic
1027674710 7:81143282-81143304 TTTTGCTTGAGGAAAGAAGAGGG + Intergenic
1028916814 7:96268477-96268499 TGGGCCTTAATGAATGAAGAGGG - Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030779430 7:113581051-113581073 CAGAAATTGATGAATGAAGAGGG - Intergenic
1030944080 7:115694460-115694482 TTGTACTTGATAGAGGAAGCAGG - Intergenic
1031225396 7:119031284-119031306 TTGTACTTTATTATTGAATAAGG + Intergenic
1033395788 7:140972659-140972681 TTGAAGATGATGAATAAAGAAGG + Intergenic
1033429186 7:141273403-141273425 ATTTAATTGATGAATAAAGATGG - Intronic
1033496305 7:141900098-141900120 TTGTACCAGATGTATAAAGAAGG + Intergenic
1033650082 7:143334966-143334988 TTGTACTTGGTTACTGTAGATGG - Intronic
1033907794 7:146226988-146227010 TTATACTAAATGAATGAAAAAGG + Intronic
1039572315 8:38597372-38597394 TTATAATTGATGGGTGAAGAGGG - Intergenic
1040878756 8:52180847-52180869 TTGTGTTTGATGACTGGAGATGG - Intronic
1041252888 8:55951789-55951811 TTCTACTTGACAAATGAAGCTGG - Intronic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1041405966 8:57499851-57499873 TTGTAATTGATGTGTGAAAATGG + Intergenic
1041416071 8:57609815-57609837 TTATGCTTGAGGAAAGAAGAAGG + Intergenic
1041441560 8:57902230-57902252 TTCTACTTGATCAGGGAAGAAGG + Intergenic
1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG + Intronic
1042942268 8:74119204-74119226 TTATAGATGATGACTGAAGAAGG - Intergenic
1043047847 8:75350510-75350532 TAGTACATGAAGAATGATGATGG - Intergenic
1043563152 8:81518727-81518749 TTGTATTTGGTGAAAGAAAAGGG + Intergenic
1043881038 8:85543237-85543259 TTCTACTTAATGTATGAAGAAGG - Intergenic
1045129741 8:99137601-99137623 TTGTTTTTGATGAAGAAAGAAGG + Intronic
1045205157 8:100031480-100031502 TAGTAATTAATGAATGAAGAGGG - Intronic
1047588490 8:126300969-126300991 TTGTATTTAATAAATGAGGAAGG - Intergenic
1047796904 8:128266988-128267010 ATTTACTTGATGAAGGAGGATGG - Intergenic
1050801524 9:9621201-9621223 TTGTCCTTTGTGAATGAAGAGGG - Intronic
1050807517 9:9699699-9699721 TTGCACTTATTGAAAGAAGAGGG + Intronic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1052093972 9:24362349-24362371 TTCTGCTTGAGGAAAGAAGAGGG + Intergenic
1052680960 9:31692003-31692025 TTCTACTTGAAGAATGAAAAGGG + Intergenic
1052749989 9:32480086-32480108 TTGTCCTGGATGTAGGAAGATGG - Intronic
1052883305 9:33619165-33619187 TTTCAGTTGATGAATGAACAGGG + Intergenic
1053360095 9:37479602-37479624 TTATACTATATGAATGAAGATGG + Intergenic
1054968760 9:71060473-71060495 TTCTACTTGTTGAATGATGTCGG - Intronic
1057167502 9:92940509-92940531 TTGTGCTAGATGAATGTGGAGGG + Intergenic
1057866437 9:98685485-98685507 ATATACTTGTTGAATGAATAAGG + Intronic
1058957536 9:109963100-109963122 TTGTTCTTGAAGAATGAGTATGG + Intronic
1060177258 9:121506138-121506160 TTTAACTTGAAGAATGGAGATGG + Intergenic
1062446270 9:136596636-136596658 GTGTACTTGAGGAAAGGAGACGG + Intergenic
1186481581 X:9900082-9900104 ATGGCCTTGATGAATGAAGCAGG - Intronic
1186490062 X:9964375-9964397 TTTTAAGTGATGAATAAAGATGG - Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1188472815 X:30559264-30559286 TTACACTTGATGAAGGAATATGG - Exonic
1190542030 X:51487019-51487041 TAGTACTTAATATATGAAGAAGG - Intergenic
1190623715 X:52315128-52315150 TAGTACTTAATGATTGAAGTTGG + Intergenic
1191881717 X:65849207-65849229 TTGTAATTGATGTCTGAAGTAGG + Intergenic
1192474980 X:71432900-71432922 TTTTACTTGAAGATTGGAGAGGG - Intronic
1193971117 X:88054781-88054803 TTGAACTCGTTGAAAGAAGATGG - Intergenic
1194358566 X:92918741-92918763 TTATACTTGAGGAGAGAAGAGGG - Intergenic
1194693162 X:97011577-97011599 TTGTTTTTCAAGAATGAAGAGGG + Intronic
1194746051 X:97629537-97629559 TTCTAATTGATGTTTGAAGAGGG + Intergenic
1196177330 X:112653588-112653610 TTTTCCTTGCTGAAGGAAGATGG + Intronic
1199593639 X:149490052-149490074 TTTTTCTTGATGAATGCAGCAGG - Intronic
1200666745 Y:6034431-6034453 TTATACTTGAAGAGAGAAGAGGG - Intergenic