ID: 1024639419

View in Genome Browser
Species Human (GRCh38)
Location 7:51317024-51317046
Sequence ACACCCGCGGGTGCGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024639409_1024639419 2 Left 1024639409 7:51316999-51317021 CCTCCGGCACCTGGGCCCTGCAC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG No data
1024639406_1024639419 15 Left 1024639406 7:51316986-51317008 CCGGGGAAGGAATCCTCCGGCAC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG No data
1024639403_1024639419 28 Left 1024639403 7:51316973-51316995 CCGCGGCGAGCGTCCGGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG No data
1024639410_1024639419 -1 Left 1024639410 7:51317002-51317024 CCGGCACCTGGGCCCTGCACCGA No data
Right 1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG No data
1024639402_1024639419 29 Left 1024639402 7:51316972-51316994 CCCGCGGCGAGCGTCCGGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG No data
1024639411_1024639419 -7 Left 1024639411 7:51317008-51317030 CCTGGGCCCTGCACCGACACCCG No data
Right 1024639419 7:51317024-51317046 ACACCCGCGGGTGCGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024639419 Original CRISPR ACACCCGCGGGTGCGGCAGA GGG Intergenic
No off target data available for this crispr