ID: 1024645799

View in Genome Browser
Species Human (GRCh38)
Location 7:51369344-51369366
Sequence TTCAGACAGAAGTGGTACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024645799_1024645802 26 Left 1024645799 7:51369344-51369366 CCGTGGTACCACTTCTGTCTGAA No data
Right 1024645802 7:51369393-51369415 TCCCCTAGGAAACACCTTAATGG No data
1024645799_1024645801 12 Left 1024645799 7:51369344-51369366 CCGTGGTACCACTTCTGTCTGAA No data
Right 1024645801 7:51369379-51369401 GCACAGTCTCTTGTTCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024645799 Original CRISPR TTCAGACAGAAGTGGTACCA CGG (reversed) Intergenic
No off target data available for this crispr