ID: 1024645801

View in Genome Browser
Species Human (GRCh38)
Location 7:51369379-51369401
Sequence GCACAGTCTCTTGTTCCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024645797_1024645801 14 Left 1024645797 7:51369342-51369364 CCCCGTGGTACCACTTCTGTCTG No data
Right 1024645801 7:51369379-51369401 GCACAGTCTCTTGTTCCCCTAGG No data
1024645798_1024645801 13 Left 1024645798 7:51369343-51369365 CCCGTGGTACCACTTCTGTCTGA No data
Right 1024645801 7:51369379-51369401 GCACAGTCTCTTGTTCCCCTAGG No data
1024645800_1024645801 4 Left 1024645800 7:51369352-51369374 CCACTTCTGTCTGAATTCTGCTG No data
Right 1024645801 7:51369379-51369401 GCACAGTCTCTTGTTCCCCTAGG No data
1024645796_1024645801 18 Left 1024645796 7:51369338-51369360 CCAGCCCCGTGGTACCACTTCTG No data
Right 1024645801 7:51369379-51369401 GCACAGTCTCTTGTTCCCCTAGG No data
1024645799_1024645801 12 Left 1024645799 7:51369344-51369366 CCGTGGTACCACTTCTGTCTGAA No data
Right 1024645801 7:51369379-51369401 GCACAGTCTCTTGTTCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024645801 Original CRISPR GCACAGTCTCTTGTTCCCCT AGG Intergenic
No off target data available for this crispr