ID: 1024646975

View in Genome Browser
Species Human (GRCh38)
Location 7:51379041-51379063
Sequence GTCCTAGCATGCTTCTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024646975_1024646978 -4 Left 1024646975 7:51379041-51379063 CCCAAACAGAAGCATGCTAGGAC No data
Right 1024646978 7:51379060-51379082 GGACATGAGGAATTACAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024646975 Original CRISPR GTCCTAGCATGCTTCTGTTT GGG (reversed) Intergenic