ID: 1024647682

View in Genome Browser
Species Human (GRCh38)
Location 7:51383502-51383524
Sequence TTCCCAGCACATGGCCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024647676_1024647682 4 Left 1024647676 7:51383475-51383497 CCTGCTGCTGCCCACCTGAGCTG No data
Right 1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG No data
1024647679_1024647682 -10 Left 1024647679 7:51383489-51383511 CCTGAGCTGCTCATTCCCAGCAC No data
Right 1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG No data
1024647674_1024647682 16 Left 1024647674 7:51383463-51383485 CCAGTGGGCAGCCCTGCTGCTGC No data
Right 1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG No data
1024647675_1024647682 5 Left 1024647675 7:51383474-51383496 CCCTGCTGCTGCCCACCTGAGCT No data
Right 1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG No data
1024647677_1024647682 -6 Left 1024647677 7:51383485-51383507 CCCACCTGAGCTGCTCATTCCCA No data
Right 1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG No data
1024647678_1024647682 -7 Left 1024647678 7:51383486-51383508 CCACCTGAGCTGCTCATTCCCAG No data
Right 1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024647682 Original CRISPR TTCCCAGCACATGGCCGGTG AGG Intergenic
No off target data available for this crispr