ID: 1024648133

View in Genome Browser
Species Human (GRCh38)
Location 7:51385593-51385615
Sequence CTGCTGTGCTGGGGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024648122_1024648133 -10 Left 1024648122 7:51385580-51385602 CCCCCTACCCCTGCTGCTGTGCT No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data
1024648117_1024648133 25 Left 1024648117 7:51385545-51385567 CCACGCCTGGCCAAGGCCTGCTC No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data
1024648121_1024648133 3 Left 1024648121 7:51385567-51385589 CCTCTTATATATACCCCCTACCC No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data
1024648118_1024648133 20 Left 1024648118 7:51385550-51385572 CCTGGCCAAGGCCTGCTCCTCTT No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data
1024648120_1024648133 9 Left 1024648120 7:51385561-51385583 CCTGCTCCTCTTATATATACCCC No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data
1024648119_1024648133 15 Left 1024648119 7:51385555-51385577 CCAAGGCCTGCTCCTCTTATATA No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data
1024648116_1024648133 28 Left 1024648116 7:51385542-51385564 CCACCACGCCTGGCCAAGGCCTG No data
Right 1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024648133 Original CRISPR CTGCTGTGCTGGGGGAAAGC TGG Intergenic
No off target data available for this crispr