ID: 1024650224

View in Genome Browser
Species Human (GRCh38)
Location 7:51397428-51397450
Sequence TCTCAACACCACCATGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024650210_1024650224 23 Left 1024650210 7:51397382-51397404 CCAGTAACTCCCTGGCCTCCTCC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650212_1024650224 13 Left 1024650212 7:51397392-51397414 CCTGGCCTCCTCCCCTACTTCTC 0: 13
1: 15
2: 16
3: 96
4: 958
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650208_1024650224 27 Left 1024650208 7:51397378-51397400 CCACCCAGTAACTCCCTGGCCTC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650214_1024650224 5 Left 1024650214 7:51397400-51397422 CCTCCCCTACTTCTCCCCTCTGG No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650219_1024650224 -9 Left 1024650219 7:51397414-51397436 CCCCTCTGGCCATCTCTCAACAC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650216_1024650224 2 Left 1024650216 7:51397403-51397425 CCCCTACTTCTCCCCTCTGGCCA No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650220_1024650224 -10 Left 1024650220 7:51397415-51397437 CCCTCTGGCCATCTCTCAACACC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650211_1024650224 14 Left 1024650211 7:51397391-51397413 CCCTGGCCTCCTCCCCTACTTCT 0: 13
1: 15
2: 15
3: 78
4: 777
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650218_1024650224 0 Left 1024650218 7:51397405-51397427 CCTACTTCTCCCCTCTGGCCATC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650217_1024650224 1 Left 1024650217 7:51397404-51397426 CCCTACTTCTCCCCTCTGGCCAT No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650206_1024650224 29 Left 1024650206 7:51397376-51397398 CCCCACCCAGTAACTCCCTGGCC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650213_1024650224 8 Left 1024650213 7:51397397-51397419 CCTCCTCCCCTACTTCTCCCCTC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650207_1024650224 28 Left 1024650207 7:51397377-51397399 CCCACCCAGTAACTCCCTGGCCT No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data
1024650209_1024650224 24 Left 1024650209 7:51397381-51397403 CCCAGTAACTCCCTGGCCTCCTC No data
Right 1024650224 7:51397428-51397450 TCTCAACACCACCATGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024650224 Original CRISPR TCTCAACACCACCATGGCCC TGG Intergenic
No off target data available for this crispr