ID: 1024655021

View in Genome Browser
Species Human (GRCh38)
Location 7:51445053-51445075
Sequence AATTTCCTGCTGCAGTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024655021_1024655023 22 Left 1024655021 7:51445053-51445075 CCAGTATACTGCAGCAGGAAATT No data
Right 1024655023 7:51445098-51445120 ACAGCCCAGCAAAAATCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024655021 Original CRISPR AATTTCCTGCTGCAGTATAC TGG (reversed) Intergenic
No off target data available for this crispr