ID: 1024657008

View in Genome Browser
Species Human (GRCh38)
Location 7:51459425-51459447
Sequence CTGAATGAACAGACGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024657008_1024657016 25 Left 1024657008 7:51459425-51459447 CCAGTCTGCGTCTGTTCATTCAG No data
Right 1024657016 7:51459473-51459495 CACCTTGCCTGACTATCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024657008 Original CRISPR CTGAATGAACAGACGCAGAC TGG (reversed) Intergenic
No off target data available for this crispr