ID: 1024657514

View in Genome Browser
Species Human (GRCh38)
Location 7:51464206-51464228
Sequence GGATGGAGATGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024657506_1024657514 29 Left 1024657506 7:51464154-51464176 CCAAGGAAGTGTTGTAAAAAAGA No data
Right 1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024657514 Original CRISPR GGATGGAGATGGAGAGAAGT GGG Intergenic
No off target data available for this crispr