ID: 1024658924

View in Genome Browser
Species Human (GRCh38)
Location 7:51474988-51475010
Sequence GGTGCATGGTGATCAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024658924_1024658932 20 Left 1024658924 7:51474988-51475010 CCCTACACTGATCACCATGCACC No data
Right 1024658932 7:51475031-51475053 ACCATTTTTTACCAAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024658924 Original CRISPR GGTGCATGGTGATCAGTGTA GGG (reversed) Intergenic