ID: 1024659847

View in Genome Browser
Species Human (GRCh38)
Location 7:51482956-51482978
Sequence CCATCATCGGCCAGGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024659847_1024659851 26 Left 1024659847 7:51482956-51482978 CCACTGAGCCTGGCCGATGATGG No data
Right 1024659851 7:51483005-51483027 TATTAGAGCCCAGTCACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024659847 Original CRISPR CCATCATCGGCCAGGCTCAG TGG (reversed) Intergenic