ID: 1024659851

View in Genome Browser
Species Human (GRCh38)
Location 7:51483005-51483027
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024659847_1024659851 26 Left 1024659847 7:51482956-51482978 CCACTGAGCCTGGCCGATGATGG No data
Right 1024659851 7:51483005-51483027 TATTAGAGCCCAGTCACAAGTGG No data
1024659849_1024659851 18 Left 1024659849 7:51482964-51482986 CCTGGCCGATGATGGCAGTCTTA No data
Right 1024659851 7:51483005-51483027 TATTAGAGCCCAGTCACAAGTGG No data
1024659850_1024659851 13 Left 1024659850 7:51482969-51482991 CCGATGATGGCAGTCTTAAATGT No data
Right 1024659851 7:51483005-51483027 TATTAGAGCCCAGTCACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024659851 Original CRISPR TATTAGAGCCCAGTCACAAG TGG Intergenic
No off target data available for this crispr