ID: 1024659852 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:51483012-51483034 |
| Sequence | GCCCAGTCACAAGTGGAAAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024659850_1024659852 | 20 | Left | 1024659850 | 7:51482969-51482991 | CCGATGATGGCAGTCTTAAATGT | No data | ||
| Right | 1024659852 | 7:51483012-51483034 | GCCCAGTCACAAGTGGAAAGTGG | No data | ||||
| 1024659849_1024659852 | 25 | Left | 1024659849 | 7:51482964-51482986 | CCTGGCCGATGATGGCAGTCTTA | No data | ||
| Right | 1024659852 | 7:51483012-51483034 | GCCCAGTCACAAGTGGAAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024659852 | Original CRISPR | GCCCAGTCACAAGTGGAAAG TGG | Intergenic | ||