ID: 1024659852

View in Genome Browser
Species Human (GRCh38)
Location 7:51483012-51483034
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024659850_1024659852 20 Left 1024659850 7:51482969-51482991 CCGATGATGGCAGTCTTAAATGT No data
Right 1024659852 7:51483012-51483034 GCCCAGTCACAAGTGGAAAGTGG No data
1024659849_1024659852 25 Left 1024659849 7:51482964-51482986 CCTGGCCGATGATGGCAGTCTTA No data
Right 1024659852 7:51483012-51483034 GCCCAGTCACAAGTGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024659852 Original CRISPR GCCCAGTCACAAGTGGAAAG TGG Intergenic