ID: 1024661537

View in Genome Browser
Species Human (GRCh38)
Location 7:51500068-51500090
Sequence ACCAGTGACCACAAGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024661537_1024661539 -9 Left 1024661537 7:51500068-51500090 CCCTCTGGCTTGTGGTCACTGGT No data
Right 1024661539 7:51500082-51500104 GTCACTGGTGTCCTCTTCTATGG No data
1024661537_1024661542 8 Left 1024661537 7:51500068-51500090 CCCTCTGGCTTGTGGTCACTGGT No data
Right 1024661542 7:51500099-51500121 CTATGGACATTGCACCTATAGGG No data
1024661537_1024661541 7 Left 1024661537 7:51500068-51500090 CCCTCTGGCTTGTGGTCACTGGT No data
Right 1024661541 7:51500098-51500120 TCTATGGACATTGCACCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024661537 Original CRISPR ACCAGTGACCACAAGCCAGA GGG (reversed) Intergenic