ID: 1024661538

View in Genome Browser
Species Human (GRCh38)
Location 7:51500069-51500091
Sequence CACCAGTGACCACAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024661538_1024661539 -10 Left 1024661538 7:51500069-51500091 CCTCTGGCTTGTGGTCACTGGTG No data
Right 1024661539 7:51500082-51500104 GTCACTGGTGTCCTCTTCTATGG No data
1024661538_1024661541 6 Left 1024661538 7:51500069-51500091 CCTCTGGCTTGTGGTCACTGGTG No data
Right 1024661541 7:51500098-51500120 TCTATGGACATTGCACCTATAGG No data
1024661538_1024661542 7 Left 1024661538 7:51500069-51500091 CCTCTGGCTTGTGGTCACTGGTG No data
Right 1024661542 7:51500099-51500121 CTATGGACATTGCACCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024661538 Original CRISPR CACCAGTGACCACAAGCCAG AGG (reversed) Intergenic
No off target data available for this crispr