ID: 1024661539

View in Genome Browser
Species Human (GRCh38)
Location 7:51500082-51500104
Sequence GTCACTGGTGTCCTCTTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024661538_1024661539 -10 Left 1024661538 7:51500069-51500091 CCTCTGGCTTGTGGTCACTGGTG No data
Right 1024661539 7:51500082-51500104 GTCACTGGTGTCCTCTTCTATGG No data
1024661537_1024661539 -9 Left 1024661537 7:51500068-51500090 CCCTCTGGCTTGTGGTCACTGGT No data
Right 1024661539 7:51500082-51500104 GTCACTGGTGTCCTCTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024661539 Original CRISPR GTCACTGGTGTCCTCTTCTA TGG Intergenic
No off target data available for this crispr