ID: 1024661542

View in Genome Browser
Species Human (GRCh38)
Location 7:51500099-51500121
Sequence CTATGGACATTGCACCTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024661537_1024661542 8 Left 1024661537 7:51500068-51500090 CCCTCTGGCTTGTGGTCACTGGT No data
Right 1024661542 7:51500099-51500121 CTATGGACATTGCACCTATAGGG No data
1024661538_1024661542 7 Left 1024661538 7:51500069-51500091 CCTCTGGCTTGTGGTCACTGGTG No data
Right 1024661542 7:51500099-51500121 CTATGGACATTGCACCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024661542 Original CRISPR CTATGGACATTGCACCTATA GGG Intergenic
No off target data available for this crispr