ID: 1024661542 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:51500099-51500121 |
Sequence | CTATGGACATTGCACCTATA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024661537_1024661542 | 8 | Left | 1024661537 | 7:51500068-51500090 | CCCTCTGGCTTGTGGTCACTGGT | No data | ||
Right | 1024661542 | 7:51500099-51500121 | CTATGGACATTGCACCTATAGGG | No data | ||||
1024661538_1024661542 | 7 | Left | 1024661538 | 7:51500069-51500091 | CCTCTGGCTTGTGGTCACTGGTG | No data | ||
Right | 1024661542 | 7:51500099-51500121 | CTATGGACATTGCACCTATAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024661542 | Original CRISPR | CTATGGACATTGCACCTATA GGG | Intergenic | ||