ID: 1024663603

View in Genome Browser
Species Human (GRCh38)
Location 7:51522798-51522820
Sequence CAGAGAAAACAAAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024663603_1024663610 13 Left 1024663603 7:51522798-51522820 CCATCCTCTTTTTGTTTTCTCTG No data
Right 1024663610 7:51522834-51522856 TCTCAGAACCATGCATTTGGGGG No data
1024663603_1024663608 11 Left 1024663603 7:51522798-51522820 CCATCCTCTTTTTGTTTTCTCTG No data
Right 1024663608 7:51522832-51522854 TTTCTCAGAACCATGCATTTGGG No data
1024663603_1024663607 10 Left 1024663603 7:51522798-51522820 CCATCCTCTTTTTGTTTTCTCTG No data
Right 1024663607 7:51522831-51522853 GTTTCTCAGAACCATGCATTTGG No data
1024663603_1024663609 12 Left 1024663603 7:51522798-51522820 CCATCCTCTTTTTGTTTTCTCTG No data
Right 1024663609 7:51522833-51522855 TTCTCAGAACCATGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024663603 Original CRISPR CAGAGAAAACAAAAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr