ID: 1024664993

View in Genome Browser
Species Human (GRCh38)
Location 7:51537073-51537095
Sequence GAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024664993_1024665005 24 Left 1024664993 7:51537073-51537095 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1024665005 7:51537120-51537142 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1024664993_1024665004 23 Left 1024664993 7:51537073-51537095 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1024665004 7:51537119-51537141 CCAGTTCCAATGAGATGAACCGG 0: 12
1: 168
2: 424
3: 391
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024664993 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr