ID: 1024670125

View in Genome Browser
Species Human (GRCh38)
Location 7:51586557-51586579
Sequence CAGCAAACTTAGAGGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024670125_1024670128 22 Left 1024670125 7:51586557-51586579 CCTGACTCCCTCTAAGTTTGCTG No data
Right 1024670128 7:51586602-51586624 AGCTCATTTGCTGCCTTCTCTGG No data
1024670125_1024670129 23 Left 1024670125 7:51586557-51586579 CCTGACTCCCTCTAAGTTTGCTG No data
Right 1024670129 7:51586603-51586625 GCTCATTTGCTGCCTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024670125 Original CRISPR CAGCAAACTTAGAGGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr