ID: 1024670127

View in Genome Browser
Species Human (GRCh38)
Location 7:51586565-51586587
Sequence ATGTTAAACAGCAAACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024670127_1024670128 14 Left 1024670127 7:51586565-51586587 CCTCTAAGTTTGCTGTTTAACAT No data
Right 1024670128 7:51586602-51586624 AGCTCATTTGCTGCCTTCTCTGG No data
1024670127_1024670129 15 Left 1024670127 7:51586565-51586587 CCTCTAAGTTTGCTGTTTAACAT No data
Right 1024670129 7:51586603-51586625 GCTCATTTGCTGCCTTCTCTGGG No data
1024670127_1024670131 29 Left 1024670127 7:51586565-51586587 CCTCTAAGTTTGCTGTTTAACAT No data
Right 1024670131 7:51586617-51586639 TTCTCTGGGTTCTTTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024670127 Original CRISPR ATGTTAAACAGCAAACTTAG AGG (reversed) Intergenic
No off target data available for this crispr