ID: 1024670129

View in Genome Browser
Species Human (GRCh38)
Location 7:51586603-51586625
Sequence GCTCATTTGCTGCCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024670127_1024670129 15 Left 1024670127 7:51586565-51586587 CCTCTAAGTTTGCTGTTTAACAT No data
Right 1024670129 7:51586603-51586625 GCTCATTTGCTGCCTTCTCTGGG No data
1024670126_1024670129 16 Left 1024670126 7:51586564-51586586 CCCTCTAAGTTTGCTGTTTAACA No data
Right 1024670129 7:51586603-51586625 GCTCATTTGCTGCCTTCTCTGGG No data
1024670125_1024670129 23 Left 1024670125 7:51586557-51586579 CCTGACTCCCTCTAAGTTTGCTG No data
Right 1024670129 7:51586603-51586625 GCTCATTTGCTGCCTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024670129 Original CRISPR GCTCATTTGCTGCCTTCTCT GGG Intergenic
No off target data available for this crispr