ID: 1024673401

View in Genome Browser
Species Human (GRCh38)
Location 7:51616880-51616902
Sequence CAGAGTGACCAGAGAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024673397_1024673401 -6 Left 1024673397 7:51616863-51616885 CCATCAGAACCCAGGCACAGAGT No data
Right 1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024673401 Original CRISPR CAGAGTGACCAGAGAGAACT GGG Intergenic
No off target data available for this crispr